EMAIL THIS PAGE TO A FRIEND

DSG3

desmoglein 3

107 Gene Product Result for
Synonyms: CDHF6 PVA
UniProtKB ID: P32926, A8K2V2
Gene ID:
Human(1830) Summary: Desmosomes are cell-cell junctions between epithelial, myocardial, and certain other cell types. Desmoglein 3 is a calcium-binding transmembrane glycoprotein component of desmosomes in vertebrate epithelial cells. Currently, three desmoglein subfamily members have been identified and all are members of the cadherin cell adhesion molecule superfamily. These desmoglein gene family members are located in a cluster on chromosome 18. This protein has been identified as the autoantigen of the autoimmune skin blistering disease pemphigus vulgaris. [provided by RefSeq, Jul 2008]
Mouse(13512) desmoglein 3
Rat(291752) desmoglein 3
dog(403470) desmoglein 3
cow(529902) desmoglein 3
sheep(101115247) desmoglein 3
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001944 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030596 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030596 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030596 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135861 MISSION® esiRNA esiRNA human DSG3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001944 Rosetta Predictions human pricing
XM_001054333 Rosetta Predictions rat pricing
XM_001061524 Rosetta Predictions rat pricing
NM_030596 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244944 predicted 773
2 SASI_Hs01_00244945 predicted 838
3 SASI_Hs01_00244946 predicted 3079
4 SASI_Hs01_00244948 predicted 2890
5 SASI_Hs02_00332857 predicted 615
6 SASI_Hs01_00244949 predicted 1000
7 SASI_Hs01_00244950 predicted 310
8 SASI_Hs01_00244951 predicted 658
9 SASI_Hs01_00244952 predicted 911
10 SASI_Hs01_00244953 predicted 2531
11 SASI_Hs01_00244947 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275509 predicted 1749
2 SASI_Rn02_00275510 predicted 1386
3 SASI_Rn02_00275511 predicted 1300
4 SASI_Rn02_00275512 predicted 1643
5 SASI_Rn02_00275513 predicted 2672
6 SASI_Rn02_00275514 predicted 780
7 SASI_Rn02_00275515 predicted 1969
8 SASI_Rn02_00275516 predicted 823
9 SASI_Rn02_00275517 predicted 1722
10 SASI_Rn02_00275518 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300390 predicted 1376
2 SASI_Rn02_00300391 predicted 1103
3 SASI_Rn02_00300392 predicted 1012
4 SASI_Rn02_00300393 predicted 2607
5 SASI_Rn02_00300394 predicted 923
6 SASI_Rn02_00300395 predicted 1267
7 SASI_Rn02_00300396 predicted 2302
8 SASI_Rn02_00300397 predicted 405
9 SASI_Rn02_00300398 predicted 1591
10 SASI_Rn02_00300399 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042345 predicted 1445
2 SASI_Mm01_00042346 predicted 1338
3 SASI_Mm02_00336793 predicted 363
4 SASI_Mm01_00042347 predicted 3032
5 SASI_Mm01_00042348 predicted 2638
6 SASI_Mm01_00042349 predicted 870
7 SASI_Mm01_00042350 predicted 1054
8 SASI_Mm01_00042352 predicted 584
9 SASI_Mm01_00042353 predicted 1352
10 SASI_Mm01_00042354 predicted 1305
11 SASI_Mm01_00042351 predicted 2341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001944
DSG3 MISSION shRNA Bacterial Glycerol Stock
desmoglein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001944.2-3227s21c1
Sequence:CCGGCATAAACTGATCACGATTATACTCGAGTATAATCGTGATCAGTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001944.2-149s21c1
Sequence:CCGGATCTTCGTGGTGGTCATATTGCTCGAGCAATATGACCACCACGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001944.2-3184s21c1
Sequence:CCGGCTCACTGTATTGGGCTAATAACTCGAGTTATTAGCCCAATACAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001944.2-481s21c1
Sequence:CCGGGATCACATGTCGGGCTCTAAACTCGAGTTTAGAGCCCGACATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001944.1-2700s1c1
Sequence:CCGGCCCTCTAAAGACAGCGGTTATCTCGAGATAACCGCTGTCTTTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001944.1-2104s1c1
Sequence:CCGGCCCATCCTGAAGACAAGGAAACTCGAGTTTCCTTGTCTTCAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001944.1-1187s1c1
Sequence:CCGGCCCAGTCACAATTCAGGTAATCTCGAGATTACCTGAATTGTGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001944.1-1650s1c1
Sequence:CCGGCCCTATACATTTGCACTGGAACTCGAGTTCCAGTGCAAATGTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001944.1-501s1c1
Sequence:CCGGCCACTTATACTAACGGTTAAACTCGAGTTTAACCGTTAGTATAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001944
DSG3 MISSION shRNA shRNA Plasmid DNA
desmoglein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001944.2-3227s21c1
Sequence:CCGGCATAAACTGATCACGATTATACTCGAGTATAATCGTGATCAGTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001944.2-149s21c1
Sequence:CCGGATCTTCGTGGTGGTCATATTGCTCGAGCAATATGACCACCACGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001944.2-3184s21c1
Sequence:CCGGCTCACTGTATTGGGCTAATAACTCGAGTTATTAGCCCAATACAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001944.2-481s21c1
Sequence:CCGGGATCACATGTCGGGCTCTAAACTCGAGTTTAGAGCCCGACATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001944.1-2700s1c1
Sequence:CCGGCCCTCTAAAGACAGCGGTTATCTCGAGATAACCGCTGTCTTTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001944.1-2104s1c1
Sequence:CCGGCCCATCCTGAAGACAAGGAAACTCGAGTTTCCTTGTCTTCAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001944.1-1187s1c1
Sequence:CCGGCCCAGTCACAATTCAGGTAATCTCGAGATTACCTGAATTGTGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001944.1-1650s1c1
Sequence:CCGGCCCTATACATTTGCACTGGAACTCGAGTTCCAGTGCAAATGTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001944.1-501s1c1
Sequence:CCGGCCACTTATACTAACGGTTAAACTCGAGTTTAACCGTTAGTATAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001944
DSG3 MISSION shRNA Lentiviral Transduction Particles
desmoglein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001944.2-3227s21c1
Sequence:CCGGCATAAACTGATCACGATTATACTCGAGTATAATCGTGATCAGTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001944.2-149s21c1
Sequence:CCGGATCTTCGTGGTGGTCATATTGCTCGAGCAATATGACCACCACGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001944.2-3184s21c1
Sequence:CCGGCTCACTGTATTGGGCTAATAACTCGAGTTATTAGCCCAATACAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001944.2-481s21c1
Sequence:CCGGGATCACATGTCGGGCTCTAAACTCGAGTTTAGAGCCCGACATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001944.1-2700s1c1
Sequence:CCGGCCCTCTAAAGACAGCGGTTATCTCGAGATAACCGCTGTCTTTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001944.1-2104s1c1
Sequence:CCGGCCCATCCTGAAGACAAGGAAACTCGAGTTTCCTTGTCTTCAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001944.1-1187s1c1
Sequence:CCGGCCCAGTCACAATTCAGGTAATCTCGAGATTACCTGAATTGTGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001944.1-1650s1c1
Sequence:CCGGCCCTATACATTTGCACTGGAACTCGAGTTCCAGTGCAAATGTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001944.1-501s1c1
Sequence:CCGGCCACTTATACTAACGGTTAAACTCGAGTTTAACCGTTAGTATAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030596
DSG3 MISSION shRNA Bacterial Glycerol Stock
desmoglein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030596.1-440s1c1
Sequence:CCGGCCATAGTTGATCGTGAGGAAACTCGAGTTTCCTCACGATCAACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030596.1-577s1c1
Sequence:CCGGCAAACCATATTCAAGGGTGAACTCGAGTTCACCCTTGAATATGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030596.1-1452s1c1
Sequence:CCGGCGACCGAGATTCTACTTTCATCTCGAGATGAAAGTAGAATCTCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030596.1-3347s1c1
Sequence:CCGGCCAAGCATCTTCACATTTCTACTCGAGTAGAAATGTGAAGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030596.1-2198s1c1
Sequence:CCGGGCTCTGAAGTTTGCACAAATACTCGAGTATTTGTGCAAACTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030596
DSG3 MISSION shRNA shRNA Plasmid DNA
desmoglein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030596.1-440s1c1
Sequence:CCGGCCATAGTTGATCGTGAGGAAACTCGAGTTTCCTCACGATCAACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030596.1-577s1c1
Sequence:CCGGCAAACCATATTCAAGGGTGAACTCGAGTTCACCCTTGAATATGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030596.1-1452s1c1
Sequence:CCGGCGACCGAGATTCTACTTTCATCTCGAGATGAAAGTAGAATCTCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030596.1-3347s1c1
Sequence:CCGGCCAAGCATCTTCACATTTCTACTCGAGTAGAAATGTGAAGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030596.1-2198s1c1
Sequence:CCGGGCTCTGAAGTTTGCACAAATACTCGAGTATTTGTGCAAACTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030596
DSG3 MISSION shRNA Lentiviral Transduction Particles
desmoglein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030596.1-440s1c1
Sequence:CCGGCCATAGTTGATCGTGAGGAAACTCGAGTTTCCTCACGATCAACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030596.1-577s1c1
Sequence:CCGGCAAACCATATTCAAGGGTGAACTCGAGTTCACCCTTGAATATGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030596.1-1452s1c1
Sequence:CCGGCGACCGAGATTCTACTTTCATCTCGAGATGAAAGTAGAATCTCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030596.1-3347s1c1
Sequence:CCGGCCAAGCATCTTCACATTTCTACTCGAGTAGAAATGTGAAGATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030596.1-2198s1c1
Sequence:CCGGGCTCTGAAGTTTGCACAAATACTCGAGTATTTGTGCAAACTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks