EMAIL THIS PAGE TO A FRIEND

DSG4

desmoglein 4

94 Gene Product Result for
Synonyms: CDGF13 CDHF13 LAH
UniProtKB ID: Q86SJ6, A2RUI1, Q6Y9L9, Q8IXV4
Gene ID:
Human(147409) Summary: This gene encodes a member of the desmoglein subgroup of desmosomal cadherins. The encoded protein is a transmembrane component in desmosomes and may play a role in cell-cell adhesion in epithelial cells. Mutations in the gene are associated with localized autosomal recessive hypotrichosis and potentially in other skin disorders. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Mouse(16769) desmoglein 4
Rat(291754) desmoglein 4
sheep(101118914) desmoglein 4
chicken(428528) desmoglein 4
cow(537755) desmoglein 4
Horse(100065957) desmoglein 4
dog(612592) desmoglein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_177986 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177986 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177986 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080061 MISSION® esiRNA esiRNA human DSG4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177986 Rosetta Predictions human pricing
NM_199490 Rosetta Predictions rat pricing
NM_181564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149810 predicted 197
2 SASI_Hs01_00149811 predicted 1161
3 SASI_Hs01_00149812 predicted 1967
4 SASI_Hs01_00149813 predicted 2747
5 SASI_Hs01_00149814 predicted 388
6 SASI_Hs02_00369458 predicted 1031
7 SASI_Hs02_00369459 predicted 956
8 SASI_Hs01_00149815 predicted 1533
9 SASI_Hs01_00149816 predicted 2926
10 SASI_Hs01_00149817 predicted 1160
11 SASI_Hs01_00149818 predicted 1848
12 SASI_Hs01_00149819 predicted 2867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199490 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045281 predicted 1391
2 SASI_Rn01_00045282 predicted 1110
3 SASI_Rn01_00045283 predicted 1161
4 SASI_Rn01_00045284 predicted 1228
5 SASI_Rn02_00270254 predicted 2391
6 SASI_Rn01_00045285 predicted 1702
7 SASI_Rn02_00270255 predicted 1631
8 SASI_Rn01_00045286 predicted 1023
9 SASI_Rn01_00045287 predicted 1006
10 SASI_Rn02_00270256 predicted 1443
11 SASI_Rn01_00045280 predicted 2788
12 SASI_Rn01_00045288 predicted 1090
13 SASI_Rn01_00045289 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040713 predicted 1393
2 SASI_Mm02_00349831 predicted 3096
3 SASI_Mm01_00040714 predicted 2535
4 SASI_Mm01_00040715 predicted 2749
5 SASI_Mm01_00040716 predicted 2920
6 SASI_Mm01_00040717 predicted 2611
7 SASI_Mm02_00349832 predicted 3213
8 SASI_Mm01_00040718 predicted 1605
9 SASI_Mm02_00349833 predicted 980
10 SASI_Mm01_00040719 predicted 684
11 SASI_Mm01_00040712 predicted 2407
12 SASI_Mm01_00040720 predicted 341
13 SASI_Mm01_00040721 predicted 1321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181564
DSG4 MISSION shRNA Bacterial Glycerol Stock
desmoglein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181564.2-3132s1c1
Sequence:CCGGCCAGAAATTCAAGTGACACAACTCGAGTTGTGTCACTTGAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181564.2-1161s1c1
Sequence:CCGGCCTAACATTTACCTCAGCATTCTCGAGAATGCTGAGGTAAATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181564.2-3298s1c1
Sequence:CCGGCATCCCATCAAAGACATATAACTCGAGTTATATGTCTTTGATGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181564.2-374s1c1
Sequence:CCGGCCAGAGGATAACCTATCGAATCTCGAGATTCGATAGGTTATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181564.2-373s1c1
Sequence:CCGGGCCAGAGGATAACCTATCGAACTCGAGTTCGATAGGTTATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181564
DSG4 MISSION shRNA shRNA Plasmid DNA
desmoglein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181564.2-3132s1c1
Sequence:CCGGCCAGAAATTCAAGTGACACAACTCGAGTTGTGTCACTTGAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181564.2-1161s1c1
Sequence:CCGGCCTAACATTTACCTCAGCATTCTCGAGAATGCTGAGGTAAATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181564.2-3298s1c1
Sequence:CCGGCATCCCATCAAAGACATATAACTCGAGTTATATGTCTTTGATGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181564.2-374s1c1
Sequence:CCGGCCAGAGGATAACCTATCGAATCTCGAGATTCGATAGGTTATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181564.2-373s1c1
Sequence:CCGGGCCAGAGGATAACCTATCGAACTCGAGTTCGATAGGTTATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181564
DSG4 MISSION shRNA Lentiviral Transduction Particles
desmoglein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181564.2-3132s1c1
Sequence:CCGGCCAGAAATTCAAGTGACACAACTCGAGTTGTGTCACTTGAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181564.2-1161s1c1
Sequence:CCGGCCTAACATTTACCTCAGCATTCTCGAGAATGCTGAGGTAAATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181564.2-3298s1c1
Sequence:CCGGCATCCCATCAAAGACATATAACTCGAGTTATATGTCTTTGATGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181564.2-374s1c1
Sequence:CCGGCCAGAGGATAACCTATCGAATCTCGAGATTCGATAGGTTATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181564.2-373s1c1
Sequence:CCGGGCCAGAGGATAACCTATCGAACTCGAGTTCGATAGGTTATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177986
DSG4 MISSION shRNA Bacterial Glycerol Stock
desmoglein 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177986.2-1361s1c1
Sequence:CCGGGCACATATACAGCCATAGATTCTCGAGAATCTATGGCTGTATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177986.2-2448s1c1
Sequence:CCGGCGCAGACATCAACATGGCTTTCTCGAGAAAGCCATGTTGATGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177986.2-1214s1c1
Sequence:CCGGCCGTTGCTTCTCAATTCCAAACTCGAGTTTGGAATTGAGAAGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177986.2-2748s1c1
Sequence:CCGGCGGACCTAATTACTTTGTTAACTCGAGTTAACAAAGTAATTAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177986.2-962s1c1
Sequence:CCGGCCAGTATTGAAGAGAATTGTTCTCGAGAACAATTCTCTTCAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177986.3-986s21c1
Sequence:CCGGGTTCGGAACTGATACGATTACCTCGAGGTAATCGTATCAGTTCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177986.3-1075s21c1
Sequence:CCGGGATGGGAATTGGTTCGATATTCTCGAGAATATCGAACCAATTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177986.3-912s21c1
Sequence:CCGGTTTAGACGTCAACGATAATTTCTCGAGAAATTATCGTTGACGTCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177986.3-3099s21c1
Sequence:CCGGACCTGTGATGAGCGGCAATATCTCGAGATATTGCCGCTCATCACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177986
DSG4 MISSION shRNA shRNA Plasmid DNA
desmoglein 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177986.2-1361s1c1
Sequence:CCGGGCACATATACAGCCATAGATTCTCGAGAATCTATGGCTGTATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177986.2-2448s1c1
Sequence:CCGGCGCAGACATCAACATGGCTTTCTCGAGAAAGCCATGTTGATGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177986.2-1214s1c1
Sequence:CCGGCCGTTGCTTCTCAATTCCAAACTCGAGTTTGGAATTGAGAAGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177986.2-2748s1c1
Sequence:CCGGCGGACCTAATTACTTTGTTAACTCGAGTTAACAAAGTAATTAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177986.2-962s1c1
Sequence:CCGGCCAGTATTGAAGAGAATTGTTCTCGAGAACAATTCTCTTCAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177986.3-986s21c1
Sequence:CCGGGTTCGGAACTGATACGATTACCTCGAGGTAATCGTATCAGTTCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177986.3-1075s21c1
Sequence:CCGGGATGGGAATTGGTTCGATATTCTCGAGAATATCGAACCAATTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177986.3-912s21c1
Sequence:CCGGTTTAGACGTCAACGATAATTTCTCGAGAAATTATCGTTGACGTCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177986.3-3099s21c1
Sequence:CCGGACCTGTGATGAGCGGCAATATCTCGAGATATTGCCGCTCATCACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177986
DSG4 MISSION shRNA Lentiviral Transduction Particles
desmoglein 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177986.2-1361s1c1
Sequence:CCGGGCACATATACAGCCATAGATTCTCGAGAATCTATGGCTGTATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177986.2-2448s1c1
Sequence:CCGGCGCAGACATCAACATGGCTTTCTCGAGAAAGCCATGTTGATGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177986.2-1214s1c1
Sequence:CCGGCCGTTGCTTCTCAATTCCAAACTCGAGTTTGGAATTGAGAAGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177986.2-2748s1c1
Sequence:CCGGCGGACCTAATTACTTTGTTAACTCGAGTTAACAAAGTAATTAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177986.2-962s1c1
Sequence:CCGGCCAGTATTGAAGAGAATTGTTCTCGAGAACAATTCTCTTCAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177986.3-986s21c1
Sequence:CCGGGTTCGGAACTGATACGATTACCTCGAGGTAATCGTATCAGTTCCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177986.3-1075s21c1
Sequence:CCGGGATGGGAATTGGTTCGATATTCTCGAGAATATCGAACCAATTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177986.3-912s21c1
Sequence:CCGGTTTAGACGTCAACGATAATTTCTCGAGAAATTATCGTTGACGTCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177986.3-3099s21c1
Sequence:CCGGACCTGTGATGAGCGGCAATATCTCGAGATATTGCCGCTCATCACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks