EMAIL THIS PAGE TO A FRIEND

DSN1

DSN1, MIS12 kinetochore complex component

54 Gene Product Result for
Synonyms: C20orf172 KNL3 MIS13 dJ469A13.2 hKNL-3
UniProtKB ID: Q9H410, B4DWT2, E1P5U9, Q5JW55, Q5JW56, Q9H8P4
Gene ID:
Human(79980) Summary: This gene encodes a kinetochore protein that functions as part of the minichromosome instability-12 centromere complex. The encoded protein is required for proper kinetochore assembly and progression through the cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2009]
Mouse(66934) DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)
Rat(499933) DSN1, MIS12 kinetochore complex component
chicken(426088) DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)
cow(508271) DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)
domestic cat(101096385) DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)
dog(610279) DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)
sheep(101123060) DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)
naked mole-rat(101711521) DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)
domestic guinea pig(100726826) DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024918 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024918 Rosetta Predictions human pricing
NM_001025768 Rosetta Predictions rat pricing
NM_025853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246377 predicted 1050
2 SASI_Hs01_00246378 predicted 555
3 SASI_Hs01_00246379 predicted 1128
4 SASI_Hs01_00246380 predicted 350
5 SASI_Hs01_00246381 predicted 899
6 SASI_Hs01_00246382 predicted 726
7 SASI_Hs01_00246383 predicted 537
8 SASI_Hs01_00246384 predicted 817
9 SASI_Hs01_00246385 predicted 336
10 SASI_Hs01_00246386 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083175 predicted 921
2 SASI_Rn01_00083176 predicted 1037
3 SASI_Rn01_00083177 predicted 419
4 SASI_Rn01_00083178 predicted 1033
5 SASI_Rn01_00083179 predicted 569
6 SASI_Rn01_00083180 predicted 908
7 SASI_Rn01_00083181 predicted 687
8 SASI_Rn01_00083182 predicted 603
9 SASI_Rn01_00083183 predicted 990
10 SASI_Rn01_00083184 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131192 predicted 777
2 SASI_Mm01_00131193 predicted 1064
3 SASI_Mm01_00131194 predicted 828
4 SASI_Mm01_00131195 predicted 303
5 SASI_Mm01_00131196 predicted 908
6 SASI_Mm01_00131197 predicted 468
7 SASI_Mm01_00131198 predicted 827
8 SASI_Mm01_00131199 predicted 1022
9 SASI_Mm01_00131200 predicted 534
10 SASI_Mm01_00131201 predicted 1076
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024918
VALIDATED
DSN1 MISSION shRNA Bacterial Glycerol Stock
DSN1, MIS12 kinetochore complex component
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024918.3-575s21c1
Sequence:CCGGCGGCGAGCAAGTATGAAAGAACTCGAGTTCTTTCATACTTGCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024918.3-725s21c1
Sequence:CCGGCAGAAACTTGAACCTTTCCTACTCGAGTAGGAAAGGTTCAAGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024918.3-650s21c1
Sequence:CCGGCGGTCTATCAGTGTCGATTTACTCGAGTAAATCGACACTGATAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024918.3-911s21c1
Sequence:CCGGGCTGAGATGAAGGAATACATACTCGAGTATGTATTCCTTCATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024918.2-324s1c1
Sequence:CCGGCCAGTGATGTCTAAGACTCATCTCGAGATGAGTCTTAGACATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024918.2-1705s1c1
Sequence:CCGGCCAAGTTGGATTCCGATTGTACTCGAGTACAATCGGAATCCAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024918.2-372s1c1
Sequence:CCGGCCTGTGGAAGTGTTTGCTAAACTCGAGTTTAGCAAACACTTCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024918.2-526s1c1
Sequence:CCGGCTCAAGAACAATCTGCCAGTTCTCGAGAACTGGCAGATTGTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024918.2-570s1c1
Sequence:CCGGCGGCGAGCAAGTATGAAAGAACTCGAGTTCTTTCATACTTGCTCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024918.2-1047s1c1
Sequence:CCGGCCTATGACATATCTTGGGTCTCTCGAGAGACCCAAGATATGTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024918.2-1257s1c1
Sequence:CCGGCAACAATTAGATCCCTCACCACTCGAGTGGTGAGGGATCTAATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024918.2-488s1c1
Sequence:CCGGCCAGGAAAGACTTCAGTCGAACTCGAGTTCGACTGAAGTCTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024918.2-906s1c1
Sequence:CCGGGCTGAGATGAAGGAATACATACTCGAGTATGTATTCCTTCATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024918.2-528s1c1
Sequence:CCGGCAAGAACAATCTGCCAGTTATCTCGAGATAACTGGCAGATTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024918.2-1048s1c1
Sequence:CCGGCTATGACATATCTTGGGTCTTCTCGAGAAGACCCAAGATATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024918.2-720s1c1
Sequence:CCGGCAGAAACTTGAACCTTTCCTACTCGAGTAGGAAAGGTTCAAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024918
VALIDATED
DSN1 MISSION shRNA shRNA Plasmid DNA
DSN1, MIS12 kinetochore complex component
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024918.3-575s21c1
Sequence:CCGGCGGCGAGCAAGTATGAAAGAACTCGAGTTCTTTCATACTTGCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024918.3-725s21c1
Sequence:CCGGCAGAAACTTGAACCTTTCCTACTCGAGTAGGAAAGGTTCAAGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024918.3-650s21c1
Sequence:CCGGCGGTCTATCAGTGTCGATTTACTCGAGTAAATCGACACTGATAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024918.3-911s21c1
Sequence:CCGGGCTGAGATGAAGGAATACATACTCGAGTATGTATTCCTTCATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024918.2-324s1c1
Sequence:CCGGCCAGTGATGTCTAAGACTCATCTCGAGATGAGTCTTAGACATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024918.2-1705s1c1
Sequence:CCGGCCAAGTTGGATTCCGATTGTACTCGAGTACAATCGGAATCCAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024918.2-372s1c1
Sequence:CCGGCCTGTGGAAGTGTTTGCTAAACTCGAGTTTAGCAAACACTTCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024918.2-526s1c1
Sequence:CCGGCTCAAGAACAATCTGCCAGTTCTCGAGAACTGGCAGATTGTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024918.2-570s1c1
Sequence:CCGGCGGCGAGCAAGTATGAAAGAACTCGAGTTCTTTCATACTTGCTCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024918.2-1047s1c1
Sequence:CCGGCCTATGACATATCTTGGGTCTCTCGAGAGACCCAAGATATGTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024918.2-1257s1c1
Sequence:CCGGCAACAATTAGATCCCTCACCACTCGAGTGGTGAGGGATCTAATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024918.2-488s1c1
Sequence:CCGGCCAGGAAAGACTTCAGTCGAACTCGAGTTCGACTGAAGTCTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024918.2-906s1c1
Sequence:CCGGGCTGAGATGAAGGAATACATACTCGAGTATGTATTCCTTCATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024918.2-528s1c1
Sequence:CCGGCAAGAACAATCTGCCAGTTATCTCGAGATAACTGGCAGATTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024918.2-1048s1c1
Sequence:CCGGCTATGACATATCTTGGGTCTTCTCGAGAAGACCCAAGATATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024918.2-720s1c1
Sequence:CCGGCAGAAACTTGAACCTTTCCTACTCGAGTAGGAAAGGTTCAAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024918
VALIDATED
DSN1 MISSION shRNA Lentiviral Transduction Particles
DSN1, MIS12 kinetochore complex component
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024918.3-575s21c1
Sequence:CCGGCGGCGAGCAAGTATGAAAGAACTCGAGTTCTTTCATACTTGCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024918.3-725s21c1
Sequence:CCGGCAGAAACTTGAACCTTTCCTACTCGAGTAGGAAAGGTTCAAGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024918.3-650s21c1
Sequence:CCGGCGGTCTATCAGTGTCGATTTACTCGAGTAAATCGACACTGATAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024918.3-911s21c1
Sequence:CCGGGCTGAGATGAAGGAATACATACTCGAGTATGTATTCCTTCATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024918.2-324s1c1
Sequence:CCGGCCAGTGATGTCTAAGACTCATCTCGAGATGAGTCTTAGACATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024918.2-1705s1c1
Sequence:CCGGCCAAGTTGGATTCCGATTGTACTCGAGTACAATCGGAATCCAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024918.2-372s1c1
Sequence:CCGGCCTGTGGAAGTGTTTGCTAAACTCGAGTTTAGCAAACACTTCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024918.2-526s1c1
Sequence:CCGGCTCAAGAACAATCTGCCAGTTCTCGAGAACTGGCAGATTGTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024918.2-570s1c1
Sequence:CCGGCGGCGAGCAAGTATGAAAGAACTCGAGTTCTTTCATACTTGCTCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024918.2-1047s1c1
Sequence:CCGGCCTATGACATATCTTGGGTCTCTCGAGAGACCCAAGATATGTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024918.2-1257s1c1
Sequence:CCGGCAACAATTAGATCCCTCACCACTCGAGTGGTGAGGGATCTAATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024918.2-488s1c1
Sequence:CCGGCCAGGAAAGACTTCAGTCGAACTCGAGTTCGACTGAAGTCTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024918.2-906s1c1
Sequence:CCGGGCTGAGATGAAGGAATACATACTCGAGTATGTATTCCTTCATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024918.2-528s1c1
Sequence:CCGGCAAGAACAATCTGCCAGTTATCTCGAGATAACTGGCAGATTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024918.2-1048s1c1
Sequence:CCGGCTATGACATATCTTGGGTCTTCTCGAGAAGACCCAAGATATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024918.2-720s1c1
Sequence:CCGGCAGAAACTTGAACCTTTCCTACTCGAGTAGGAAAGGTTCAAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025853
VALIDATED
DSN1 MISSION shRNA Bacterial Glycerol Stock
DSN1, MIS12 kinetochore complex component
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025853.2-391s1c1
Sequence:CCGGGCAAGCATGAAAGAAGTAAACCTCGAGGTTTACTTCTTTCATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025853.2-1764s1c1
Sequence:CCGGGTTAGTGAATGGCGTGTTATTCTCGAGAATAACACGCCATTCACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025853.1-888s1c1
Sequence:CCGGCTTCCCAGAAGGAAGTTCTTACTCGAGTAAGAACTTCCTTCTGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025853.1-1066s1c1
Sequence:CCGGGAAGAGAAGTATGGACCAATTCTCGAGAATTGGTCCATACTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193607    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025853.1-1911s1c1
Sequence:CCGGGCCTAGAACAATGTTATAGTTCTCGAGAACTATAACATTGTTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025853.1-920s1c1
Sequence:CCGGGACTACCAGAGAATAGTACAACTCGAGTTGTACTATTCTCTGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025853.1-928s1c1
Sequence:CCGGGAGAATAGTACAAGATCAGAACTCGAGTTCTGATCTTGTACTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025853.1-553s1c1
Sequence:CCGGCTTAAAGAACACTAAGGACTTCTCGAGAAGTCCTTAGTGTTCTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025853.1-173s1c1
Sequence:CCGGCCAAGTCTCAAGCCTTTGGAACTCGAGTTCCAAAGGCTTGAGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025853
VALIDATED
DSN1 MISSION shRNA shRNA Plasmid DNA
DSN1, MIS12 kinetochore complex component
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025853.2-391s1c1
Sequence:CCGGGCAAGCATGAAAGAAGTAAACCTCGAGGTTTACTTCTTTCATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025853.2-1764s1c1
Sequence:CCGGGTTAGTGAATGGCGTGTTATTCTCGAGAATAACACGCCATTCACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025853.1-888s1c1
Sequence:CCGGCTTCCCAGAAGGAAGTTCTTACTCGAGTAAGAACTTCCTTCTGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025853.1-1066s1c1
Sequence:CCGGGAAGAGAAGTATGGACCAATTCTCGAGAATTGGTCCATACTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193607    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025853.1-1911s1c1
Sequence:CCGGGCCTAGAACAATGTTATAGTTCTCGAGAACTATAACATTGTTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025853.1-920s1c1
Sequence:CCGGGACTACCAGAGAATAGTACAACTCGAGTTGTACTATTCTCTGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025853.1-928s1c1
Sequence:CCGGGAGAATAGTACAAGATCAGAACTCGAGTTCTGATCTTGTACTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025853.1-553s1c1
Sequence:CCGGCTTAAAGAACACTAAGGACTTCTCGAGAAGTCCTTAGTGTTCTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025853.1-173s1c1
Sequence:CCGGCCAAGTCTCAAGCCTTTGGAACTCGAGTTCCAAAGGCTTGAGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025853
VALIDATED
DSN1 MISSION shRNA Lentiviral Transduction Particles
DSN1, MIS12 kinetochore complex component
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025853.2-391s1c1
Sequence:CCGGGCAAGCATGAAAGAAGTAAACCTCGAGGTTTACTTCTTTCATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025853.2-1764s1c1
Sequence:CCGGGTTAGTGAATGGCGTGTTATTCTCGAGAATAACACGCCATTCACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025853.1-888s1c1
Sequence:CCGGCTTCCCAGAAGGAAGTTCTTACTCGAGTAAGAACTTCCTTCTGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025853.1-1066s1c1
Sequence:CCGGGAAGAGAAGTATGGACCAATTCTCGAGAATTGGTCCATACTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193607    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025853.1-1911s1c1
Sequence:CCGGGCCTAGAACAATGTTATAGTTCTCGAGAACTATAACATTGTTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025853.1-920s1c1
Sequence:CCGGGACTACCAGAGAATAGTACAACTCGAGTTGTACTATTCTCTGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025853.1-928s1c1
Sequence:CCGGGAGAATAGTACAAGATCAGAACTCGAGTTCTGATCTTGTACTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025853.1-553s1c1
Sequence:CCGGCTTAAAGAACACTAAGGACTTCTCGAGAAGTCCTTAGTGTTCTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025853.1-173s1c1
Sequence:CCGGCCAAGTCTCAAGCCTTTGGAACTCGAGTTCCAAAGGCTTGAGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks