EMAIL THIS PAGE TO A FRIEND

DSP

desmoplakin

124 Gene Product Result for
Synonyms: DP DPI DPII
UniProtKB ID: P15924, B2RTT2, O75993, Q14189, Q9UHN4
Gene ID:
Human(1832) Summary: Desmosomes are intercellular junctions that tightly link adjacent cells. Desmoplakin is an obligate component of functional desmosomes that anchors intermediate filaments to desmosomal plaques. The N-terminus of desmoplakin is required for localization to the desmosome and interacts with the N-terminal region of plakophilin 1 and plakoglobin. The C-terminus of desmoplakin binds with intermediate filaments. In the mid-region of desmoplakin, a coiled-coiled rod domain is responsible for homodimerization. Mutations in this gene are the cause of several cardiomyopathies and keratodermas as well as the autoimmune disease paraneoplastic pemphigus. [provided by RefSeq, Jul 2008]
Mouse(109620) desmoplakin
Rat(306871) desmoplakin
fruit fly(45846) dispersed
cow(514360) desmoplakin
Horse(100061514) desmoplakin
chicken(420869) desmoplakin
dog(488207) desmoplakin
sheep(101119169) desmoplakin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_621314 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_621314 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_621314 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004415 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007001 MISSION® esiRNA esiRNA targeting human DSP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008844 Rosetta Predictions human pricing
NM_004415 Rosetta Predictions human pricing
XM_001058415 Rosetta Predictions rat pricing
XM_001058477 Rosetta Predictions rat pricing
XM_001068439 Rosetta Predictions rat pricing
XM_225259 Rosetta Predictions rat pricing
NM_023842 Rosetta Predictions mouse pricing
XM_001481272 Rosetta Predictions mouse pricing
XM_621314 Rosetta Predictions mouse pricing
XM_896350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305583 predicted 3136
2 SASI_Hs01_00178297 predicted 4312
3 SASI_Hs01_00178298 predicted 4160
4 SASI_Hs01_00178299 predicted 719
5 SASI_Hs02_00305584 predicted 5324
6 SASI_Hs01_00178300 predicted 5622
7 SASI_Hs01_00178301 predicted 6823
8 SASI_Hs01_00178302 predicted 3601
9 SASI_Hs01_00178303 predicted 5745
10 SASI_Hs01_00178305 predicted 7077
11 SASI_Hs01_00178304 predicted 5390
12 SASI_Hs01_00178306 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337562 predicted 3135
2 SASI_Hs01_00086580 predicted 6108
3 SASI_Hs01_00086581 predicted 5961
4 SASI_Hs01_00086582 predicted 712
5 SASI_Hs02_00337563 predicted 7117
6 SASI_Hs01_00086583 predicted 7420
7 SASI_Hs01_00086584 predicted 8629
8 SASI_Hs01_00086585 predicted 3595
9 SASI_Hs01_00086586 predicted 7543
10 SASI_Hs01_00086588 predicted 8869
11 SASI_Hs01_00086587 predicted 7193
12 SASI_Hs01_00086589 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058415 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289623 predicted 4487
2 SASI_Rn02_00289624 predicted 2313
3 SASI_Rn02_00289625 predicted 1987
4 SASI_Rn02_00289626 predicted 3265
5 SASI_Rn02_00289627 predicted 2295
6 SASI_Rn02_00289628 predicted 3131
7 SASI_Rn02_00289629 predicted 6172
8 SASI_Rn02_00289630 predicted 4794
9 SASI_Rn02_00289631 predicted 5070
10 SASI_Rn02_00289632 predicted 5960
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058477 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289879 predicted 6275
2 SASI_Rn02_00289880 predicted 2309
3 SASI_Rn02_00289881 predicted 1986
4 SASI_Rn02_00289882 predicted 3259
5 SASI_Rn02_00289883 predicted 3132
6 SASI_Rn02_00289884 predicted 7971
7 SASI_Rn02_00289885 predicted 6596
8 SASI_Rn02_00289886 predicted 6869
9 SASI_Rn02_00289887 predicted 4960
10 SASI_Rn02_00289888 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068439 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324547 predicted 4479
2 SASI_Rn02_00324548 predicted 2308
3 SASI_Rn02_00324549 predicted 1989
4 SASI_Rn02_00324550 predicted 3262
5 SASI_Rn02_00324551 predicted 2292
6 SASI_Rn02_00324552 predicted 3128
7 SASI_Rn02_00324553 predicted 6174
8 SASI_Rn02_00324554 predicted 4799
9 SASI_Rn02_00324555 predicted 5077
10 SASI_Rn02_00324556 predicted 5960
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382677 predicted 6280
2 SASI_Rn02_00382678 predicted 2312
3 SASI_Rn02_00382679 predicted 1994
4 SASI_Rn02_00382680 predicted 3261
5 SASI_Rn02_00382681 predicted 3132
6 SASI_Rn02_00382682 predicted 7965
7 SASI_Rn02_00382683 predicted 6590
8 SASI_Rn02_00382684 predicted 6867
9 SASI_Rn02_00382685 predicted 4959
10 SASI_Rn02_00382686 predicted 1222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327383 predicted 7340
2 SASI_Mm02_00327384 predicted 7104
3 SASI_Mm02_00327385 predicted 7747
4 SASI_Mm02_00327386 predicted 8865
5 SASI_Mm02_00327387 predicted 6577
6 SASI_Mm02_00327388 predicted 3249
7 SASI_Mm02_00327389 predicted 3575
8 SASI_Mm02_00327390 predicted 4301
9 SASI_Mm02_00327391 predicted 2285
10 SASI_Mm02_00327392 predicted 6190
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423296 predicted 7637
2 SASI_Mm02_00423297 predicted 7032
3 SASI_Mm02_00423298 predicted 6787
4 SASI_Mm02_00423299 predicted 7437
5 SASI_Mm02_00423300 predicted 8555
6 SASI_Mm02_00423301 predicted 6268
7 SASI_Mm02_00423302 predicted 2936
8 SASI_Mm02_00423303 predicted 3262
9 SASI_Mm02_00423304 predicted 3994
10 SASI_Mm02_00423305 predicted 1973
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_621314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267128 predicted 7343
2 SASI_Mm02_00427766 predicted 7103
3 SASI_Mm01_00267129 predicted 7747
4 SASI_Mm01_00267130 predicted 8874
5 SASI_Mm01_00267131 predicted 6582
6 SASI_Mm01_00267132 predicted 3243
7 SASI_Mm01_00267133 predicted 3575
8 SASI_Mm01_00267134 predicted 4306
9 SASI_Mm01_00267135 predicted 2288
10 SASI_Mm01_00267136 predicted 6187
11 SASI_Mm01_00267127 predicted 7953
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229388 predicted 6151
2 SASI_Mm01_00229389 predicted 5547
3 SASI_Mm02_00429728 predicted 5306
4 SASI_Mm01_00229390 predicted 5946
5 SASI_Mm01_00229391 predicted 7072
6 SASI_Mm01_00229392 predicted 4778
7 SASI_Mm01_00229393 predicted 3251
8 SASI_Mm01_00229394 predicted 3575
9 SASI_Mm01_00229395 predicted 2285
10 SASI_Mm01_00229396 predicted 4392
11 SASI_Mm01_00229397 predicted 1705
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_621314
VALIDATED
DSP MISSION shRNA Bacterial Glycerol Stock
desmoplakin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_621314.1-7678s1c1
Sequence:CCGGGCCTACAAGAAAGGTCTCATTCTCGAGAATGAGACCTTTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_621314.1-3236s1c1
Sequence:CCGGCGAGATACATTGAACTGCTTACTCGAGTAAGCAGTTCAATGTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_621314.1-6789s1c1
Sequence:CCGGGCTGAGAGAAAGGTGCAGAATCTCGAGATTCTGCACCTTTCTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_621314.1-346s1c1
Sequence:CCGGCCGGAACTGAAATTCGGAGAACTCGAGTTCTCCGAATTTCAGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_621314.1-1075s1c1
Sequence:CCGGCGAGAGATCATGTGGATCAATCTCGAGATTGATCCACATGATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_621314
VALIDATED
DSP MISSION shRNA shRNA Plasmid DNA
desmoplakin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_621314.1-7678s1c1
Sequence:CCGGGCCTACAAGAAAGGTCTCATTCTCGAGAATGAGACCTTTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_621314.1-3236s1c1
Sequence:CCGGCGAGATACATTGAACTGCTTACTCGAGTAAGCAGTTCAATGTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_621314.1-6789s1c1
Sequence:CCGGGCTGAGAGAAAGGTGCAGAATCTCGAGATTCTGCACCTTTCTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_621314.1-346s1c1
Sequence:CCGGCCGGAACTGAAATTCGGAGAACTCGAGTTCTCCGAATTTCAGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_621314.1-1075s1c1
Sequence:CCGGCGAGAGATCATGTGGATCAATCTCGAGATTGATCCACATGATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_621314
VALIDATED
DSP MISSION shRNA Lentiviral Transduction Particles
desmoplakin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_621314.1-7678s1c1
Sequence:CCGGGCCTACAAGAAAGGTCTCATTCTCGAGAATGAGACCTTTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_621314.1-3236s1c1
Sequence:CCGGCGAGATACATTGAACTGCTTACTCGAGTAAGCAGTTCAATGTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_621314.1-6789s1c1
Sequence:CCGGGCTGAGAGAAAGGTGCAGAATCTCGAGATTCTGCACCTTTCTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_621314.1-346s1c1
Sequence:CCGGCCGGAACTGAAATTCGGAGAACTCGAGTTCTCCGAATTTCAGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_621314.1-1075s1c1
Sequence:CCGGCGAGAGATCATGTGGATCAATCTCGAGATTGATCCACATGATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004415
VALIDATED
DSP MISSION shRNA Bacterial Glycerol Stock
desmoplakin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004415.2-9076s1c1
Sequence:CCGGGCTCATCTTAAATAAGCAGTACTCGAGTACTGCTTATTTAAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004415.2-8034s1c1
Sequence:CCGGCCGACATGAATCAGTAAGTAACTCGAGTTACTTACTGATTCATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004415.2-550s1c1
Sequence:CCGGCCTGAATTGAAGTATGGAGATCTCGAGATCTCCATACTTCAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004415.2-2415s1c1
Sequence:CCGGGCAGAATGATTCACAAGCAATCTCGAGATTGCTTGTGAATCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004415.2-3140s1c1
Sequence:CCGGGCGCCAATTCAATTAAGGATTCTCGAGAATCCTTAATTGAATTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004415.2-2415s21c1
Sequence:CCGGGCAGAATGATTCACAAGCAATCTCGAGATTGCTTGTGAATCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004415.2-3140s21c1
Sequence:CCGGGCGCCAATTCAATTAAGGATTCTCGAGAATCCTTAATTGAATTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004415.2-550s21c1
Sequence:CCGGCCTGAATTGAAGTATGGAGATCTCGAGATCTCCATACTTCAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004415.2-8034s21c1
Sequence:CCGGCCGACATGAATCAGTAAGTAACTCGAGTTACTTACTGATTCATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004415
VALIDATED
DSP MISSION shRNA shRNA Plasmid DNA
desmoplakin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004415.2-9076s1c1
Sequence:CCGGGCTCATCTTAAATAAGCAGTACTCGAGTACTGCTTATTTAAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004415.2-8034s1c1
Sequence:CCGGCCGACATGAATCAGTAAGTAACTCGAGTTACTTACTGATTCATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004415.2-550s1c1
Sequence:CCGGCCTGAATTGAAGTATGGAGATCTCGAGATCTCCATACTTCAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004415.2-2415s1c1
Sequence:CCGGGCAGAATGATTCACAAGCAATCTCGAGATTGCTTGTGAATCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004415.2-3140s1c1
Sequence:CCGGGCGCCAATTCAATTAAGGATTCTCGAGAATCCTTAATTGAATTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004415.2-2415s21c1
Sequence:CCGGGCAGAATGATTCACAAGCAATCTCGAGATTGCTTGTGAATCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004415.2-3140s21c1
Sequence:CCGGGCGCCAATTCAATTAAGGATTCTCGAGAATCCTTAATTGAATTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004415.2-550s21c1
Sequence:CCGGCCTGAATTGAAGTATGGAGATCTCGAGATCTCCATACTTCAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004415.2-8034s21c1
Sequence:CCGGCCGACATGAATCAGTAAGTAACTCGAGTTACTTACTGATTCATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004415
VALIDATED
DSP MISSION shRNA Lentiviral Transduction Particles
desmoplakin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004415.2-9076s1c1
Sequence:CCGGGCTCATCTTAAATAAGCAGTACTCGAGTACTGCTTATTTAAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004415.2-8034s1c1
Sequence:CCGGCCGACATGAATCAGTAAGTAACTCGAGTTACTTACTGATTCATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004415.2-550s1c1
Sequence:CCGGCCTGAATTGAAGTATGGAGATCTCGAGATCTCCATACTTCAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004415.2-2415s1c1
Sequence:CCGGGCAGAATGATTCACAAGCAATCTCGAGATTGCTTGTGAATCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004415.2-3140s1c1
Sequence:CCGGGCGCCAATTCAATTAAGGATTCTCGAGAATCCTTAATTGAATTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004415.2-2415s21c1
Sequence:CCGGGCAGAATGATTCACAAGCAATCTCGAGATTGCTTGTGAATCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004415.2-3140s21c1
Sequence:CCGGGCGCCAATTCAATTAAGGATTCTCGAGAATCCTTAATTGAATTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004415.2-550s21c1
Sequence:CCGGCCTGAATTGAAGTATGGAGATCTCGAGATCTCCATACTTCAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004415.2-8034s21c1
Sequence:CCGGCCGACATGAATCAGTAAGTAACTCGAGTTACTTACTGATTCATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks