EMAIL THIS PAGE TO A FRIEND

DSPP

dentin sialophosphoprotein

81 Gene Product Result for
Synonyms: DFNA39 DGI1 DMP3 DPP DSP DTDP2
UniProtKB ID: Q9NZW4, A8MUI0, O95815
Gene ID:
Human(1834) Summary: This gene encodes two principal proteins of the dentin extracellular matrix of the tooth. The preproprotein is secreted by odontoblasts and cleaved into dentin sialoprotein and dentin phosphoprotein. Dentin phosphoprotein is thought to be involved in the biomineralization process of dentin. Mutations in this gene have been associated with dentinogenesis imperfecta-1; in some individuals, dentinogenesis imperfecta occurs in combination with an autosomal dominant form of deafness. Allelic differences due to repeat polymorphisms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(666279) dentin sialophosphoprotein
Rat(25254) dentin sialophosphoprotein
chicken(776475) dentin sialophosphoprotein
dog(100683557) dentin sialophosphoprotein
domestic cat(101099202) dentin sialophosphoprotein
cow(100337125) dentin sialophosphoprotein
naked mole-rat(101724668) dentin sialophosphoprotein
domestic guinea pig(101789124) dentin sialophosphoprotein
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014208 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010080 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010080 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010080 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014208 Rosetta Predictions human pricing
NM_012790 Rosetta Predictions rat pricing
NM_010080 Rosetta Predictions mouse pricing
XM_986747 Rosetta Predictions mouse pricing
XM_986777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124227 predicted 326
2 SASI_Hs01_00124228 predicted 1303
3 SASI_Hs01_00124229 predicted 296
4 SASI_Hs01_00124230 predicted 1451
5 SASI_Hs01_00124231 predicted 1230
6 SASI_Hs01_00124232 predicted 680
7 SASI_Hs02_00345228 predicted 856
8 SASI_Hs01_00124233 predicted 817
9 SASI_Hs01_00124234 predicted 833
10 SASI_Hs01_00124235 predicted 360
11 SASI_Hs01_00124236 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110274 predicted 1076
2 SASI_Rn01_00110276 predicted 2993
3 SASI_Rn01_00110277 predicted 1249
4 SASI_Rn01_00110278 predicted 1026
5 SASI_Rn01_00110279 predicted 948
6 SASI_Rn01_00110280 predicted 851
7 SASI_Rn02_00260213 predicted 700
8 SASI_Rn01_00110281 predicted 1292
9 SASI_Rn01_00110282 predicted 413
10 SASI_Rn01_00110283 predicted 577
11 SASI_Rn01_00110275 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121351 predicted 1370
2 SASI_Mm01_00121352 predicted 983
3 SASI_Mm01_00121353 predicted 1321
4 SASI_Mm02_00317771 predicted 1153
5 SASI_Mm01_00121354 predicted 644
6 SASI_Mm01_00121356 predicted 1106
7 SASI_Mm01_00121357 predicted 631
8 SASI_Mm01_00121359 predicted 947
9 SASI_Mm01_00121360 predicted 1472
10 SASI_Mm02_00317772 predicted 768
11 SASI_Mm01_00121355 predicted 990
12 SASI_Mm01_00121358 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265242 predicted 551
2 SASI_Mm01_00265243 predicted 1301
3 SASI_Mm01_00265244 predicted 243
4 SASI_Mm01_00265245 predicted 580
5 SASI_Mm01_00265246 predicted 244
6 SASI_Mm01_00265247 predicted 572
7 SASI_Mm01_00265248 predicted 495
8 SASI_Mm01_00265249 predicted 565
9 SASI_Mm01_00265250 predicted 265
10 SASI_Mm01_00265251 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270926 predicted 1383
2 SASI_Mm01_00270927 predicted 999
3 SASI_Mm01_00270928 predicted 1335
4 SASI_Mm01_00270929 predicted 1160
5 SASI_Mm01_00270930 predicted 666
6 SASI_Mm01_00270931 predicted 987
7 SASI_Mm01_00270932 predicted 1117
8 SASI_Mm01_00270933 predicted 642
9 SASI_Mm01_00270934 predicted 1137
10 SASI_Mm01_00270935 predicted 1492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014208
DSPP MISSION shRNA Bacterial Glycerol Stock
dentin sialophosphoprotein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014208.3-1668s21c1
Sequence:CCGGTAGCACATCAGACACTAATAACTCGAGTTATTAGTGTCTGATGTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014208.3-825s21c1
Sequence:CCGGAGATGCTGGCCTGGATAATTCCTCGAGGAATTATCCAGGCCAGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014208.3-223s21c1
Sequence:CCGGCATCTCCTAGCAAGATCAAATCTCGAGATTTGATCTTGCTAGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014208.1-2684s1c1
Sequence:CCGGGCAGCAATAGAAGTGACAGTACTCGAGTACTGTCACTTCTATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014208.1-3920s1c1
Sequence:CCGGGTTTGGTAATGGGATAGGAAACTCGAGTTTCCTATCCCATTACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014208.1-1232s1c1
Sequence:CCGGGCCAAGATAAGGGAATAGAAACTCGAGTTTCTATTCCCTTATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014208.1-1580s1c1
Sequence:CCGGGCCGAGGAGATGCTTCTTATACTCGAGTATAAGAAGCATCTCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014208.1-738s1c1
Sequence:CCGGCGAGGGTAATACAAGTGAAATCTCGAGATTTCACTTGTATTACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014208
DSPP MISSION shRNA shRNA Plasmid DNA
dentin sialophosphoprotein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014208.3-1668s21c1
Sequence:CCGGTAGCACATCAGACACTAATAACTCGAGTTATTAGTGTCTGATGTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014208.3-825s21c1
Sequence:CCGGAGATGCTGGCCTGGATAATTCCTCGAGGAATTATCCAGGCCAGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014208.3-223s21c1
Sequence:CCGGCATCTCCTAGCAAGATCAAATCTCGAGATTTGATCTTGCTAGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014208.1-2684s1c1
Sequence:CCGGGCAGCAATAGAAGTGACAGTACTCGAGTACTGTCACTTCTATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014208.1-3920s1c1
Sequence:CCGGGTTTGGTAATGGGATAGGAAACTCGAGTTTCCTATCCCATTACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014208.1-1232s1c1
Sequence:CCGGGCCAAGATAAGGGAATAGAAACTCGAGTTTCTATTCCCTTATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014208.1-1580s1c1
Sequence:CCGGGCCGAGGAGATGCTTCTTATACTCGAGTATAAGAAGCATCTCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014208.1-738s1c1
Sequence:CCGGCGAGGGTAATACAAGTGAAATCTCGAGATTTCACTTGTATTACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014208
DSPP MISSION shRNA Lentiviral Transduction Particles
dentin sialophosphoprotein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014208.3-1668s21c1
Sequence:CCGGTAGCACATCAGACACTAATAACTCGAGTTATTAGTGTCTGATGTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014208.3-825s21c1
Sequence:CCGGAGATGCTGGCCTGGATAATTCCTCGAGGAATTATCCAGGCCAGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014208.3-223s21c1
Sequence:CCGGCATCTCCTAGCAAGATCAAATCTCGAGATTTGATCTTGCTAGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014208.1-2684s1c1
Sequence:CCGGGCAGCAATAGAAGTGACAGTACTCGAGTACTGTCACTTCTATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014208.1-3920s1c1
Sequence:CCGGGTTTGGTAATGGGATAGGAAACTCGAGTTTCCTATCCCATTACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014208.1-1232s1c1
Sequence:CCGGGCCAAGATAAGGGAATAGAAACTCGAGTTTCTATTCCCTTATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014208.1-1580s1c1
Sequence:CCGGGCCGAGGAGATGCTTCTTATACTCGAGTATAAGAAGCATCTCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014208.1-738s1c1
Sequence:CCGGCGAGGGTAATACAAGTGAAATCTCGAGATTTCACTTGTATTACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010080
DSPP MISSION shRNA Bacterial Glycerol Stock
dentin sialophosphoprotein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010080.2-1634s21c1
Sequence:CCGGGATGGTGACAGTGACAGTAATCTCGAGATTACTGTCACTGTCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010080.2-280s21c1
Sequence:CCGGGATAGGAGAGCAGGTACTTAGCTCGAGCTAAGTACCTGCTCTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010080.2-323s21c1
Sequence:CCGGGGGAATGGCTCCGAGTCAATACTCGAGTATTGACTCGGAGCCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010080.2-2893s21c1
Sequence:CCGGCCACTCAACCAGTGATGATTACTCGAGTAATCATCACTGGTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010080.2-3651s21c1
Sequence:CCGGTTTCGGGAGGTGGGATCATATCTCGAGATATGATCCCACCTCCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010080.1-1043s1c1
Sequence:CCGGGTGTTGAAGAAGGCGACAGTACTCGAGTACTGTCGCCTTCTTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201619    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010080.1-4003s1c1
Sequence:CCGGCCCAGAGTTTCAGAAGAGTTTCTCGAGAAACTCTTCTGAAACTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010080.1-149s1c1
Sequence:CCGGCCCAGTTAGTACCACTGGAAACTCGAGTTTCCAGTGGTACTAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010080
DSPP MISSION shRNA shRNA Plasmid DNA
dentin sialophosphoprotein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010080.2-1634s21c1
Sequence:CCGGGATGGTGACAGTGACAGTAATCTCGAGATTACTGTCACTGTCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010080.2-280s21c1
Sequence:CCGGGATAGGAGAGCAGGTACTTAGCTCGAGCTAAGTACCTGCTCTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010080.2-323s21c1
Sequence:CCGGGGGAATGGCTCCGAGTCAATACTCGAGTATTGACTCGGAGCCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010080.2-2893s21c1
Sequence:CCGGCCACTCAACCAGTGATGATTACTCGAGTAATCATCACTGGTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010080.2-3651s21c1
Sequence:CCGGTTTCGGGAGGTGGGATCATATCTCGAGATATGATCCCACCTCCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010080.1-1043s1c1
Sequence:CCGGGTGTTGAAGAAGGCGACAGTACTCGAGTACTGTCGCCTTCTTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201619    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010080.1-4003s1c1
Sequence:CCGGCCCAGAGTTTCAGAAGAGTTTCTCGAGAAACTCTTCTGAAACTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010080.1-149s1c1
Sequence:CCGGCCCAGTTAGTACCACTGGAAACTCGAGTTTCCAGTGGTACTAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010080
DSPP MISSION shRNA Lentiviral Transduction Particles
dentin sialophosphoprotein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010080.2-1634s21c1
Sequence:CCGGGATGGTGACAGTGACAGTAATCTCGAGATTACTGTCACTGTCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010080.2-280s21c1
Sequence:CCGGGATAGGAGAGCAGGTACTTAGCTCGAGCTAAGTACCTGCTCTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010080.2-323s21c1
Sequence:CCGGGGGAATGGCTCCGAGTCAATACTCGAGTATTGACTCGGAGCCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010080.2-2893s21c1
Sequence:CCGGCCACTCAACCAGTGATGATTACTCGAGTAATCATCACTGGTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010080.2-3651s21c1
Sequence:CCGGTTTCGGGAGGTGGGATCATATCTCGAGATATGATCCCACCTCCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010080.1-1043s1c1
Sequence:CCGGGTGTTGAAGAAGGCGACAGTACTCGAGTACTGTCGCCTTCTTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201619    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010080.1-4003s1c1
Sequence:CCGGCCCAGAGTTTCAGAAGAGTTTCTCGAGAAACTCTTCTGAAACTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010080.1-149s1c1
Sequence:CCGGCCCAGTTAGTACCACTGGAAACTCGAGTTTCCAGTGGTACTAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks