EMAIL THIS PAGE TO A FRIEND

DST

dystonin

204 Gene Product Result for
Synonyms: BP240 BPA BPAG1 CATX-15 CATX15 D6S1101 DMH DT HSAN6 MACF2
Gene ID:
Human(667) Summary: This gene encodes a member of the plakin protein family of adhesion junction plaque proteins. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the full-length nature of some variants has not been defined. It has been reported that some isoforms are expressed in neural and muscle tissue, anchoring neural intermediate filaments to the actin cytoskeleton, and some isoforms are expressed in epithelial tissue, anchoring keratin-containing intermediate filaments to hemidesmosomes. Consistent with the expression, mice defective for this gene show skin blistering and neurodegeneration. [provided by RefSeq, Mar 2010]
Mouse(13518) dystonin
Rat(316313) dystonin
sheep(101113020) dystonin
cow(535297) dystonin
Horse(100056885) dystonin
chicken(421884) dystonin
dog(474948) dystonin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010081 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010081 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010081 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001723 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133833 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133833 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133833 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001723 Rosetta Predictions human pricing
NM_015548 Rosetta Predictions human pricing
NM_020388 Rosetta Predictions human pricing
NM_183380 Rosetta Predictions human pricing
NM_001108208 Rosetta Predictions rat pricing
NM_010081 Rosetta Predictions mouse pricing
NM_133833 Rosetta Predictions mouse pricing
NM_134448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332423 predicted 1246
2 SASI_Hs01_00147162 predicted 1162
3 SASI_Hs01_00147163 predicted 1219
4 SASI_Hs01_00147164 predicted 1878
5 SASI_Hs01_00147165 predicted 716
6 SASI_Hs01_00147166 predicted 2986
7 SASI_Hs01_00147167 predicted 629
8 SASI_Hs01_00147168 predicted 621
9 SASI_Hs01_00147169 predicted 544
10 SASI_Hs02_00332424 predicted 1683
11 SASI_Hs01_00147170 predicted 602
12 SASI_Hs01_00147171 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348077 predicted 1250
2 SASI_Hs01_00230979 predicted 1158
3 SASI_Hs01_00230980 predicted 1217
4 SASI_Hs01_00230981 predicted 1878
5 SASI_Hs01_00230982 predicted 710
6 SASI_Hs01_00230983 predicted 2992
7 SASI_Hs01_00230984 predicted 627
8 SASI_Hs01_00230985 predicted 619
9 SASI_Hs01_00230986 predicted 552
10 SASI_Hs02_00348078 predicted 1686
11 SASI_Hs01_00230987 predicted 605
12 SASI_Hs01_00230988 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353359 predicted 1255
2 SASI_Hs01_00018915 predicted 1161
3 SASI_Hs01_00018916 predicted 1216
4 SASI_Hs01_00018917 predicted 1880
5 SASI_Hs01_00018918 predicted 712
6 SASI_Hs01_00018919 predicted 2989
7 SASI_Hs01_00018920 predicted 628
8 SASI_Hs01_00018921 predicted 618
9 SASI_Hs01_00018922 predicted 551
10 SASI_Hs02_00353360 predicted 1683
11 SASI_Hs01_00018923 predicted 609
12 SASI_Hs01_00018924 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371288 predicted 2644
2 SASI_Hs01_00112634 predicted 2552
3 SASI_Hs01_00112635 predicted 2604
4 SASI_Hs01_00112636 predicted 3273
5 SASI_Hs01_00112637 predicted 2098
6 SASI_Hs01_00112638 predicted 4384
7 SASI_Hs01_00112639 predicted 2022
8 SASI_Hs01_00112640 predicted 2007
9 SASI_Hs01_00112641 predicted 1942
10 SASI_Hs02_00371289 predicted 3082
11 SASI_Hs01_00112642 predicted 2002
12 SASI_Hs01_00112643 predicted 1933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236384 predicted 11785
2 SASI_Rn02_00236385 predicted 18260
3 SASI_Rn02_00236386 predicted 16906
4 SASI_Rn02_00236387 predicted 15168
5 SASI_Rn02_00236388 predicted 18739
6 SASI_Rn02_00236389 predicted 17943
7 SASI_Rn02_00236390 predicted 17982
8 SASI_Rn02_00236391 predicted 20951
9 SASI_Rn02_00236392 predicted 14792
10 SASI_Rn02_00236393 predicted 22094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085262 predicted 1276
2 SASI_Mm01_00085263 predicted 2196
3 SASI_Mm01_00085264 predicted 2487
4 SASI_Mm01_00085265 predicted 2092
5 SASI_Mm01_00085266 predicted 1763
6 SASI_Mm01_00085267 predicted 438
7 SASI_Mm01_00085268 predicted 428
8 SASI_Mm01_00085269 predicted 502
9 SASI_Mm01_00085270 predicted 516
10 SASI_Mm01_00085271 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338857 predicted 14412
2 SASI_Mm02_00338858 predicted 283
3 SASI_Mm02_00338859 predicted 7106
4 SASI_Mm02_00338860 predicted 7064
5 SASI_Mm02_00338861 predicted 5863
6 SASI_Mm01_00068567 predicted 3073
7 SASI_Mm01_00068568 predicted 2751
8 SASI_Mm02_00338862 predicted 11947
9 SASI_Mm01_00068570 predicted 1411
10 SASI_Mm02_00338863 predicted 6568
11 SASI_Mm01_00068564 predicted 2272
12 SASI_Mm01_00068565 predicted 3197
13 SASI_Mm01_00068566 predicted 3488
14 SASI_Mm01_00068569 predicted 1436
15 SASI_Mm01_00068571 predicted 1503
16 SASI_Mm01_00068572 predicted 1518
17 SASI_Mm01_00068573 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339569 predicted 20447
2 SASI_Mm02_00339570 predicted 288
3 SASI_Mm02_00339571 predicted 13153
4 SASI_Mm02_00339572 predicted 13108
5 SASI_Mm02_00339573 predicted 11901
6 SASI_Mm01_00093535 predicted 3077
7 SASI_Mm01_00093536 predicted 2748
8 SASI_Mm02_00339574 predicted 17990
9 SASI_Mm01_00093538 predicted 1413
10 SASI_Mm02_00339575 predicted 12613
11 SASI_Mm01_00093532 predicted 2270
12 SASI_Mm01_00093533 predicted 3196
13 SASI_Mm01_00093534 predicted 3480
14 SASI_Mm01_00093537 predicted 1434
15 SASI_Mm01_00093539 predicted 1504
16 SASI_Mm01_00093540 predicted 1510
17 SASI_Mm01_00093541 predicted 1373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010081
VALIDATED
DST MISSION shRNA Bacterial Glycerol Stock
dystonin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010081.1-2105s1c1
Sequence:CCGGCGGATATAAGTCAACTAGAAACTCGAGTTTCTAGTTGACTTATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010081.1-2566s1c1
Sequence:CCGGGCCCTTGTCAAACTCTACGAACTCGAGTTCGTAGAGTTTGACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010081.1-6856s1c1
Sequence:CCGGGCTCTGTATTATTCGGAGTTACTCGAGTAACTCCGAATAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010081.1-2567s1c1
Sequence:CCGGCCCTTGTCAAACTCTACGAAACTCGAGTTTCGTAGAGTTTGACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010081.1-1462s1c1
Sequence:CCGGGCCACTGATTACCTAAGGAATCTCGAGATTCCTTAGGTAATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010081
VALIDATED
DST MISSION shRNA shRNA Plasmid DNA
dystonin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010081.1-2105s1c1
Sequence:CCGGCGGATATAAGTCAACTAGAAACTCGAGTTTCTAGTTGACTTATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010081.1-2566s1c1
Sequence:CCGGGCCCTTGTCAAACTCTACGAACTCGAGTTCGTAGAGTTTGACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010081.1-6856s1c1
Sequence:CCGGGCTCTGTATTATTCGGAGTTACTCGAGTAACTCCGAATAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010081.1-2567s1c1
Sequence:CCGGCCCTTGTCAAACTCTACGAAACTCGAGTTTCGTAGAGTTTGACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010081.1-1462s1c1
Sequence:CCGGGCCACTGATTACCTAAGGAATCTCGAGATTCCTTAGGTAATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010081
VALIDATED
DST MISSION shRNA Lentiviral Transduction Particles
dystonin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010081.1-2105s1c1
Sequence:CCGGCGGATATAAGTCAACTAGAAACTCGAGTTTCTAGTTGACTTATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010081.1-2566s1c1
Sequence:CCGGGCCCTTGTCAAACTCTACGAACTCGAGTTCGTAGAGTTTGACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010081.1-6856s1c1
Sequence:CCGGGCTCTGTATTATTCGGAGTTACTCGAGTAACTCCGAATAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010081.1-2567s1c1
Sequence:CCGGCCCTTGTCAAACTCTACGAAACTCGAGTTTCGTAGAGTTTGACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010081.1-1462s1c1
Sequence:CCGGGCCACTGATTACCTAAGGAATCTCGAGATTCCTTAGGTAATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001723
VALIDATED
DST MISSION shRNA Bacterial Glycerol Stock
dystonin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001723.3-4982s1c1
Sequence:CCGGGCACAAATGAACACTTGCATACTCGAGTATGCAAGTGTTCATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001723.3-5990s1c1
Sequence:CCGGGCACCGAGTTACAGATAACTTCTCGAGAAGTTATCTGTAACTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001723.3-170s1c1
Sequence:CCGGCCAGTCTTGATTCAAATGAAACTCGAGTTTCATTTGAATCAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001723.3-7000s1c1
Sequence:CCGGGCTCTGTATTACTCAGAATTACTCGAGTAATTCTGAGTAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001723.3-1212s1c1
Sequence:CCGGGCACCTTGATACACTCCATAACTCGAGTTATGGAGTGTATCAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001723.4-1218s21c1
Sequence:CCGGGCACCTTGATACACTCCATAACTCGAGTTATGGAGTGTATCAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001723.4-495s21c1
Sequence:CCGGATACTACCAGGCAGATCAATTCTCGAGAATTGATCTGCCTGGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001723.4-7659s21c1
Sequence:CCGGGCGACAGTGTGAATTAGTAATCTCGAGATTACTAATTCACACTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001723.4-8320s21c1
Sequence:CCGGTACGTAGAATGTGGGATAAACCTCGAGGTTTATCCCACATTCTACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001723.4-3332s21c1
Sequence:CCGGTGGACCTAAGGACTCGATATACTCGAGTATATCGAGTCCTTAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001723
VALIDATED
DST MISSION shRNA shRNA Plasmid DNA
dystonin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001723.3-4982s1c1
Sequence:CCGGGCACAAATGAACACTTGCATACTCGAGTATGCAAGTGTTCATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001723.3-5990s1c1
Sequence:CCGGGCACCGAGTTACAGATAACTTCTCGAGAAGTTATCTGTAACTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001723.3-170s1c1
Sequence:CCGGCCAGTCTTGATTCAAATGAAACTCGAGTTTCATTTGAATCAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001723.3-7000s1c1
Sequence:CCGGGCTCTGTATTACTCAGAATTACTCGAGTAATTCTGAGTAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001723.3-1212s1c1
Sequence:CCGGGCACCTTGATACACTCCATAACTCGAGTTATGGAGTGTATCAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001723.4-1218s21c1
Sequence:CCGGGCACCTTGATACACTCCATAACTCGAGTTATGGAGTGTATCAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001723.4-495s21c1
Sequence:CCGGATACTACCAGGCAGATCAATTCTCGAGAATTGATCTGCCTGGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001723.4-7659s21c1
Sequence:CCGGGCGACAGTGTGAATTAGTAATCTCGAGATTACTAATTCACACTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001723.4-8320s21c1
Sequence:CCGGTACGTAGAATGTGGGATAAACCTCGAGGTTTATCCCACATTCTACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001723.4-3332s21c1
Sequence:CCGGTGGACCTAAGGACTCGATATACTCGAGTATATCGAGTCCTTAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001723
VALIDATED
DST MISSION shRNA Lentiviral Transduction Particles
dystonin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001723.3-4982s1c1
Sequence:CCGGGCACAAATGAACACTTGCATACTCGAGTATGCAAGTGTTCATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001723.3-5990s1c1
Sequence:CCGGGCACCGAGTTACAGATAACTTCTCGAGAAGTTATCTGTAACTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001723.3-170s1c1
Sequence:CCGGCCAGTCTTGATTCAAATGAAACTCGAGTTTCATTTGAATCAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001723.3-7000s1c1
Sequence:CCGGGCTCTGTATTACTCAGAATTACTCGAGTAATTCTGAGTAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001723.3-1212s1c1
Sequence:CCGGGCACCTTGATACACTCCATAACTCGAGTTATGGAGTGTATCAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001723.4-1218s21c1
Sequence:CCGGGCACCTTGATACACTCCATAACTCGAGTTATGGAGTGTATCAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001723.4-495s21c1
Sequence:CCGGATACTACCAGGCAGATCAATTCTCGAGAATTGATCTGCCTGGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001723.4-7659s21c1
Sequence:CCGGGCGACAGTGTGAATTAGTAATCTCGAGATTACTAATTCACACTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001723.4-8320s21c1
Sequence:CCGGTACGTAGAATGTGGGATAAACCTCGAGGTTTATCCCACATTCTACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001723.4-3332s21c1
Sequence:CCGGTGGACCTAAGGACTCGATATACTCGAGTATATCGAGTCCTTAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133833
DST MISSION shRNA Bacterial Glycerol Stock
dystonin
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133833.2-4231s21c1
Sequence:CCGGACTCTTATGACGCAGTATATTCTCGAGAATATACTGCGTCATAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133833.2-6376s21c1
Sequence:CCGGGGTCGTCAAAGCAGCATAAATCTCGAGATTTATGCTGCTTTGACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133833.2-3080s21c1
Sequence:CCGGTATTCTCAGGCTCGGATATAACTCGAGTTATATCCGAGCCTGAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133833.2-2970s21c1
Sequence:CCGGTAGTAATGTGGCTTCGATAAACTCGAGTTTATCGAAGCCACATTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133833.2-16574s21c1
Sequence:CCGGGCGATGCTCTAACTGTAAATTCTCGAGAATTTACAGTTAGAGCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133833.2-15312s21c1
Sequence:CCGGAGTTGAACAGATCGGTGATAACTCGAGTTATCACCGATCTGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133833
DST MISSION shRNA shRNA Plasmid DNA
dystonin
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133833.2-4231s21c1
Sequence:CCGGACTCTTATGACGCAGTATATTCTCGAGAATATACTGCGTCATAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133833.2-6376s21c1
Sequence:CCGGGGTCGTCAAAGCAGCATAAATCTCGAGATTTATGCTGCTTTGACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133833.2-3080s21c1
Sequence:CCGGTATTCTCAGGCTCGGATATAACTCGAGTTATATCCGAGCCTGAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133833.2-2970s21c1
Sequence:CCGGTAGTAATGTGGCTTCGATAAACTCGAGTTTATCGAAGCCACATTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133833.2-16574s21c1
Sequence:CCGGGCGATGCTCTAACTGTAAATTCTCGAGAATTTACAGTTAGAGCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133833.2-15312s21c1
Sequence:CCGGAGTTGAACAGATCGGTGATAACTCGAGTTATCACCGATCTGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133833
DST MISSION shRNA Lentiviral Transduction Particles
dystonin
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133833.2-4231s21c1
Sequence:CCGGACTCTTATGACGCAGTATATTCTCGAGAATATACTGCGTCATAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133833.2-6376s21c1
Sequence:CCGGGGTCGTCAAAGCAGCATAAATCTCGAGATTTATGCTGCTTTGACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133833.2-3080s21c1
Sequence:CCGGTATTCTCAGGCTCGGATATAACTCGAGTTATATCCGAGCCTGAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133833.2-2970s21c1
Sequence:CCGGTAGTAATGTGGCTTCGATAAACTCGAGTTTATCGAAGCCACATTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133833.2-16574s21c1
Sequence:CCGGGCGATGCTCTAACTGTAAATTCTCGAGAATTTACAGTTAGAGCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133833.2-15312s21c1
Sequence:CCGGAGTTGAACAGATCGGTGATAACTCGAGTTATCACCGATCTGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks