EMAIL THIS PAGE TO A FRIEND

DSTN

destrin (actin depolymerizing factor)

116 Gene Product Result for
Synonyms: ACTDP ADF bA462D18.2
UniProtKB ID: P60981, B2R6N2, B4DYA6, P18282, Q5W166, Q6IAW2
Gene ID:
Human(11034) Summary: The product of this gene belongs to the actin-binding proteins ADF family. This family of proteins is responsible for enhancing the turnover rate of actin in vivo. This gene encodes the actin depolymerizing protein that severs actin filaments (F-actin) and binds to actin monomers (G-actin). Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(56431) destrin
Rat(502674) destrin
chicken(396539) destrin (actin depolymerizing factor)
cow(513267) destrin (actin depolymerizing factor)
domestic cat(101098531) destrin (actin depolymerizing factor)
dog(477147) destrin (actin depolymerizing factor)
naked mole-rat(101711367) destrin (actin depolymerizing factor)
domestic guinea pig(100727332) destrin (actin depolymerizing factor)
sheep(101119923) destrin (actin depolymerizing factor)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006870 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011546 Rosetta Predictions human pricing
NM_006870 Rosetta Predictions human pricing
NM_001033666 Rosetta Predictions rat pricing
NM_019771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060014 predicted 1350
2 SASI_Hs01_00060017 predicted 1306
3 SASI_Hs02_00305981 predicted 1295
4 SASI_Hs01_00060019 predicted 1336
5 SASI_Hs01_00060020 predicted 1366
6 SASI_Hs02_00305982 predicted 1356
7 SASI_Hs02_00305983 predicted 1003
8 SASI_Hs01_00060021 predicted 1238
9 SASI_Hs01_00060022 predicted 1063
10 SASI_Hs02_00305984 predicted 1278
11 SASI_Hs01_00060015 predicted 923
12 SASI_Hs01_00060016 predicted 1248
13 SASI_Hs01_00060018 predicted 1177
14 SASI_Hs01_00060023 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020751 predicted 1212
2 SASI_Hs01_00020754 predicted 1176
3 SASI_Hs02_00342506 predicted 1165
4 SASI_Hs01_00020756 predicted 1206
5 SASI_Hs01_00020757 predicted 1241
6 SASI_Hs02_00342507 predicted 1219
7 SASI_Hs02_00342508 predicted 868
8 SASI_Hs01_00020758 predicted 1106
9 SASI_Hs01_00020759 predicted 930
10 SASI_Hs02_00342509 predicted 1153
11 SASI_Hs01_00020752 predicted 794
12 SASI_Hs01_00020753 predicted 1123
13 SASI_Hs01_00020755 predicted 1050
14 SASI_Hs01_00020760 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065824 predicted 288
2 SASI_Rn01_00065833 predicted 540
3 SASI_Rn02_00203667 predicted 247
4 SASI_Rn02_00203668 predicted 138
5 SASI_Rn02_00203669 predicted 137
6 SASI_Rn02_00203670 predicted 131
7 SASI_Rn01_00065825 predicted 677
8 SASI_Rn01_00065826 predicted 781
9 SASI_Rn01_00065827 predicted 664
10 SASI_Rn01_00065828 predicted 798
11 SASI_Rn01_00065829 predicted 505
12 SASI_Rn01_00065830 predicted 717
13 SASI_Rn01_00065831 predicted 310
14 SASI_Rn01_00065832 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129527 predicted 1010
2 SASI_Mm01_00129528 predicted 990
3 SASI_Mm01_00129530 predicted 684
4 SASI_Mm01_00129531 predicted 971
5 SASI_Mm01_00129532 predicted 565
6 SASI_Mm01_00129533 predicted 700
7 SASI_Mm01_00129534 predicted 823
8 SASI_Mm01_00129535 predicted 414
9 SASI_Mm01_00129536 predicted 489
10 SASI_Mm02_00324970 predicted 820
11 SASI_Mm01_00129529 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019771
VALIDATED
DSTN MISSION shRNA Bacterial Glycerol Stock
destrin (actin depolymerizing factor)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019771.2-766s21c1
Sequence:CCGGAGCTAGGTGGCTCCTTAATTGCTCGAGCAATTAAGGAGCCACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019771.2-499s21c1
Sequence:CCGGCCACCATAACTGATCCTTTCACTCGAGTGAAAGGATCAGTTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019771.2-561s21c1
Sequence:CCGGGCTTTGTATGACGCCAGCTTTCTCGAGAAAGCTGGCGTCATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019771.2-361s21c1
Sequence:CCGGACGACATGAAAGTTCGGAAATCTCGAGATTTCCGAACTTTCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019771.2-1537s21c1
Sequence:CCGGGCAAATTATTAGGGCTTCATTCTCGAGAATGAAGCCCTAATAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019771.1-1258s1c1
Sequence:CCGGGCAAATTATTAGGGCTTCATTCTCGAGAATGAAGCCCTAATAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019771.1-281s1c1
Sequence:CCGGGCTTTGTATGACGCCAGCTTTCTCGAGAAAGCTGGCGTCATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019771.1-219s1c1
Sequence:CCGGCCACCATAACTGATCCTTTCACTCGAGTGAAAGGATCAGTTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019771.1-217s1c1
Sequence:CCGGCGCCACCATAACTGATCCTTTCTCGAGAAAGGATCAGTTATGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019771.1-419s1c1
Sequence:CCGGCCAGGTATAAAGCATGAGTATCTCGAGATACTCATGCTTTATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019771
VALIDATED
DSTN MISSION shRNA shRNA Plasmid DNA
destrin (actin depolymerizing factor)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019771.2-766s21c1
Sequence:CCGGAGCTAGGTGGCTCCTTAATTGCTCGAGCAATTAAGGAGCCACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019771.2-499s21c1
Sequence:CCGGCCACCATAACTGATCCTTTCACTCGAGTGAAAGGATCAGTTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019771.2-561s21c1
Sequence:CCGGGCTTTGTATGACGCCAGCTTTCTCGAGAAAGCTGGCGTCATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019771.2-361s21c1
Sequence:CCGGACGACATGAAAGTTCGGAAATCTCGAGATTTCCGAACTTTCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019771.2-1537s21c1
Sequence:CCGGGCAAATTATTAGGGCTTCATTCTCGAGAATGAAGCCCTAATAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019771.1-1258s1c1
Sequence:CCGGGCAAATTATTAGGGCTTCATTCTCGAGAATGAAGCCCTAATAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019771.1-281s1c1
Sequence:CCGGGCTTTGTATGACGCCAGCTTTCTCGAGAAAGCTGGCGTCATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019771.1-219s1c1
Sequence:CCGGCCACCATAACTGATCCTTTCACTCGAGTGAAAGGATCAGTTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019771.1-217s1c1
Sequence:CCGGCGCCACCATAACTGATCCTTTCTCGAGAAAGGATCAGTTATGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019771.1-419s1c1
Sequence:CCGGCCAGGTATAAAGCATGAGTATCTCGAGATACTCATGCTTTATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019771
VALIDATED
DSTN MISSION shRNA Lentiviral Transduction Particles
destrin (actin depolymerizing factor)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019771.2-766s21c1
Sequence:CCGGAGCTAGGTGGCTCCTTAATTGCTCGAGCAATTAAGGAGCCACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019771.2-499s21c1
Sequence:CCGGCCACCATAACTGATCCTTTCACTCGAGTGAAAGGATCAGTTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019771.2-561s21c1
Sequence:CCGGGCTTTGTATGACGCCAGCTTTCTCGAGAAAGCTGGCGTCATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019771.2-361s21c1
Sequence:CCGGACGACATGAAAGTTCGGAAATCTCGAGATTTCCGAACTTTCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019771.2-1537s21c1
Sequence:CCGGGCAAATTATTAGGGCTTCATTCTCGAGAATGAAGCCCTAATAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019771.1-1258s1c1
Sequence:CCGGGCAAATTATTAGGGCTTCATTCTCGAGAATGAAGCCCTAATAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019771.1-281s1c1
Sequence:CCGGGCTTTGTATGACGCCAGCTTTCTCGAGAAAGCTGGCGTCATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019771.1-219s1c1
Sequence:CCGGCCACCATAACTGATCCTTTCACTCGAGTGAAAGGATCAGTTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019771.1-217s1c1
Sequence:CCGGCGCCACCATAACTGATCCTTTCTCGAGAAAGGATCAGTTATGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019771.1-419s1c1
Sequence:CCGGCCAGGTATAAAGCATGAGTATCTCGAGATACTCATGCTTTATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006870
VALIDATED
DSTN MISSION shRNA Bacterial Glycerol Stock
destrin (actin depolymerizing factor)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006870.3-502s21c1
Sequence:CCGGGCTTTGTATGATGCAAGCTTTCTCGAGAAAGCTTGCATCATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006870.3-610s21c1
Sequence:CCGGAGCTCCAAGGATGCAATTAAACTCGAGTTTAATTGCATCCTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006870.3-679s21c1
Sequence:CCGGGATCTCAATCGGGCTTGTATTCTCGAGAATACAAGCCCGATTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006870.3-714s21c1
Sequence:CCGGTGGATCCTTAATTGTAGCCTTCTCGAGAAGGCTACAATTAAGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006870.3-1313s21c1
Sequence:CCGGGCGCTATTTCAGGCACATCATCTCGAGATGATGTGCCTGAAATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006870.3-1313s1c1
Sequence:CCGGGCGCTATTTCAGGCACATCATCTCGAGATGATGTGCCTGAAATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006870.3-679s1c1
Sequence:CCGGGATCTCAATCGGGCTTGTATTCTCGAGAATACAAGCCCGATTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006870.3-610s1c1
Sequence:CCGGAGCTCCAAGGATGCAATTAAACTCGAGTTTAATTGCATCCTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006870.3-714s1c1
Sequence:CCGGTGGATCCTTAATTGTAGCCTTCTCGAGAAGGCTACAATTAAGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006870.3-502s1c1
Sequence:CCGGGCTTTGTATGATGCAAGCTTTCTCGAGAAAGCTTGCATCATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006870
VALIDATED
DSTN MISSION shRNA shRNA Plasmid DNA
destrin (actin depolymerizing factor)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006870.3-502s21c1
Sequence:CCGGGCTTTGTATGATGCAAGCTTTCTCGAGAAAGCTTGCATCATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006870.3-610s21c1
Sequence:CCGGAGCTCCAAGGATGCAATTAAACTCGAGTTTAATTGCATCCTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006870.3-679s21c1
Sequence:CCGGGATCTCAATCGGGCTTGTATTCTCGAGAATACAAGCCCGATTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006870.3-714s21c1
Sequence:CCGGTGGATCCTTAATTGTAGCCTTCTCGAGAAGGCTACAATTAAGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006870.3-1313s21c1
Sequence:CCGGGCGCTATTTCAGGCACATCATCTCGAGATGATGTGCCTGAAATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006870.3-1313s1c1
Sequence:CCGGGCGCTATTTCAGGCACATCATCTCGAGATGATGTGCCTGAAATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006870.3-679s1c1
Sequence:CCGGGATCTCAATCGGGCTTGTATTCTCGAGAATACAAGCCCGATTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006870.3-610s1c1
Sequence:CCGGAGCTCCAAGGATGCAATTAAACTCGAGTTTAATTGCATCCTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006870.3-714s1c1
Sequence:CCGGTGGATCCTTAATTGTAGCCTTCTCGAGAAGGCTACAATTAAGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006870.3-502s1c1
Sequence:CCGGGCTTTGTATGATGCAAGCTTTCTCGAGAAAGCTTGCATCATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006870
VALIDATED
DSTN MISSION shRNA Lentiviral Transduction Particles
destrin (actin depolymerizing factor)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006870.3-502s21c1
Sequence:CCGGGCTTTGTATGATGCAAGCTTTCTCGAGAAAGCTTGCATCATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006870.3-610s21c1
Sequence:CCGGAGCTCCAAGGATGCAATTAAACTCGAGTTTAATTGCATCCTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006870.3-679s21c1
Sequence:CCGGGATCTCAATCGGGCTTGTATTCTCGAGAATACAAGCCCGATTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006870.3-714s21c1
Sequence:CCGGTGGATCCTTAATTGTAGCCTTCTCGAGAAGGCTACAATTAAGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006870.3-1313s21c1
Sequence:CCGGGCGCTATTTCAGGCACATCATCTCGAGATGATGTGCCTGAAATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006870.3-1313s1c1
Sequence:CCGGGCGCTATTTCAGGCACATCATCTCGAGATGATGTGCCTGAAATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006870.3-679s1c1
Sequence:CCGGGATCTCAATCGGGCTTGTATTCTCGAGAATACAAGCCCGATTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006870.3-610s1c1
Sequence:CCGGAGCTCCAAGGATGCAATTAAACTCGAGTTTAATTGCATCCTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006870.3-714s1c1
Sequence:CCGGTGGATCCTTAATTGTAGCCTTCTCGAGAAGGCTACAATTAAGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006870.3-502s1c1
Sequence:CCGGGCTTTGTATGATGCAAGCTTTCTCGAGAAAGCTTGCATCATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks