EMAIL THIS PAGE TO A FRIEND

DSTYK

dual serine/threonine and tyrosine protein kinase

175 Gene Product Result for
Synonyms: CAKUT1 DustyPK RIP5 RIPK5
Gene ID:
Human(25778) Summary: This gene encodes a dual serine/threonine and tyrosine protein kinase which is expressed in multiple tissues. It is thought to function as a regulator of cell death. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Mouse(213452) dual serine/threonine and tyrosine protein kinase
Rat(304791) dual serine/threonine and tyrosine protein kinase
Zebrafish(402922) dual serine/threonine and tyrosine protein kinase
cow(534684) dual serine/threonine and tyrosine protein kinase
Horse(100054758) dual serine/threonine and tyrosine protein kinase
domestic cat(101085430) dual serine/threonine and tyrosine protein kinase
dog(478942) dual serine/threonine and tyrosine protein kinase
chicken(395171) dual serine/threonine and tyrosine protein kinase
domestic guinea pig(100718419) dual serine/threonine and tyrosine protein kinase
naked mole-rat(101712117) dual serine/threonine and tyrosine protein kinase
sheep(101109553) dual serine/threonine and tyrosine protein kinase
Domestic Rabbit(100350101) dual serine/threonine and tyrosine protein kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015375 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015375 Rosetta Predictions human pricing
NM_199462 Rosetta Predictions human pricing
NM_199463 Rosetta Predictions rat pricing
NM_172516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181492 predicted 1763
2 SASI_Hs01_00181493 predicted 1347
3 SASI_Hs01_00181494 predicted 1547
4 SASI_Hs01_00181495 predicted 1435
5 SASI_Hs01_00181496 predicted 1665
6 SASI_Hs02_00347725 predicted 2094
7 SASI_Hs01_00181498 predicted 1614
8 SASI_Hs01_00181499 predicted 1758
9 SASI_Hs01_00181500 predicted 2203
10 SASI_Hs01_00181501 predicted 1386
11 SASI_Hs01_00181497 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234191 predicted 1766
2 SASI_Hs01_00234192 predicted 1349
3 SASI_Hs01_00234193 predicted 1552
4 SASI_Hs01_00234194 predicted 1437
5 SASI_Hs01_00234195 predicted 1659
6 SASI_Hs02_00372868 predicted 2091
7 SASI_Hs01_00234197 predicted 1616
8 SASI_Hs01_00234198 predicted 1761
9 SASI_Hs01_00234199 predicted 2205
10 SASI_Hs01_00234200 predicted 1393
11 SASI_Hs01_00234196 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270244 predicted 1329
2 SASI_Rn01_00114270 predicted 2628
3 SASI_Rn01_00114271 predicted 2188
4 SASI_Rn01_00114272 predicted 2432
5 SASI_Rn01_00114273 predicted 1257
6 SASI_Rn02_00270245 predicted 919
7 SASI_Rn01_00114274 predicted 1912
8 SASI_Rn01_00114275 predicted 1981
9 SASI_Rn01_00114276 predicted 1305
10 SASI_Rn01_00114277 predicted 790
11 SASI_Rn01_00114269 predicted 227
12 SASI_Rn01_00114278 predicted 1348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078761 predicted 650
2 SASI_Mm01_00078762 predicted 2068
3 SASI_Mm01_00078763 predicted 2076
4 SASI_Mm01_00078764 predicted 1407
5 SASI_Mm01_00078765 predicted 2185
6 SASI_Mm01_00078766 predicted 1420
7 SASI_Mm01_00078768 predicted 2711
8 SASI_Mm01_00078769 predicted 1163
9 SASI_Mm01_00078770 predicted 2527
10 SASI_Mm02_00344114 predicted 1460
11 SASI_Mm01_00078767 predicted 1888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172516
VALIDATED
DSTYK MISSION shRNA Bacterial Glycerol Stock
dual serine/threonine and tyrosine protein kinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172516.3-3182s1c1
Sequence:CCGGCCACTTAGAAACATGACCTTACTCGAGTAAGGTCATGTTTCTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172516.3-2603s1c1
Sequence:CCGGGCAAAGACCATCTCTGGAATACTCGAGTATTCCAGAGATGGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172516.3-1269s1c1
Sequence:CCGGGCAAGAGGAAATGAAGGATATCTCGAGATATCCTTCATTTCCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172516.3-775s1c1
Sequence:CCGGCCTGTGATAACCTATGCACTTCTCGAGAAGTGCATAGGTTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172516.3-1953s1c1
Sequence:CCGGCCGGTCTTTACAGGATGTCTTCTCGAGAAGACATCCTGTAAAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172516.4-3319s21c1
Sequence:CCGGTCCAGATTGTATGGTCATAAACTCGAGTTTATGACCATACAATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172516.4-1383s21c1
Sequence:CCGGGCAAGAGGAAATGAAGGATATCTCGAGATATCCTTCATTTCCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172516.4-2717s21c1
Sequence:CCGGGCAAAGACCATCTCTGGAATACTCGAGTATTCCAGAGATGGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172516.4-889s21c1
Sequence:CCGGCCTGTGATAACCTATGCACTTCTCGAGAAGTGCATAGGTTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172516.4-2067s21c1
Sequence:CCGGCCGGTCTTTACAGGATGTCTTCTCGAGAAGACATCCTGTAAAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172516
VALIDATED
DSTYK MISSION shRNA shRNA Plasmid DNA
dual serine/threonine and tyrosine protein kinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172516.3-3182s1c1
Sequence:CCGGCCACTTAGAAACATGACCTTACTCGAGTAAGGTCATGTTTCTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172516.3-2603s1c1
Sequence:CCGGGCAAAGACCATCTCTGGAATACTCGAGTATTCCAGAGATGGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172516.3-1269s1c1
Sequence:CCGGGCAAGAGGAAATGAAGGATATCTCGAGATATCCTTCATTTCCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172516.3-775s1c1
Sequence:CCGGCCTGTGATAACCTATGCACTTCTCGAGAAGTGCATAGGTTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172516.3-1953s1c1
Sequence:CCGGCCGGTCTTTACAGGATGTCTTCTCGAGAAGACATCCTGTAAAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172516.4-3319s21c1
Sequence:CCGGTCCAGATTGTATGGTCATAAACTCGAGTTTATGACCATACAATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172516.4-1383s21c1
Sequence:CCGGGCAAGAGGAAATGAAGGATATCTCGAGATATCCTTCATTTCCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172516.4-2717s21c1
Sequence:CCGGGCAAAGACCATCTCTGGAATACTCGAGTATTCCAGAGATGGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172516.4-889s21c1
Sequence:CCGGCCTGTGATAACCTATGCACTTCTCGAGAAGTGCATAGGTTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172516.4-2067s21c1
Sequence:CCGGCCGGTCTTTACAGGATGTCTTCTCGAGAAGACATCCTGTAAAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172516
VALIDATED
DSTYK MISSION shRNA Lentiviral Transduction Particles
dual serine/threonine and tyrosine protein kinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172516.3-3182s1c1
Sequence:CCGGCCACTTAGAAACATGACCTTACTCGAGTAAGGTCATGTTTCTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172516.3-2603s1c1
Sequence:CCGGGCAAAGACCATCTCTGGAATACTCGAGTATTCCAGAGATGGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172516.3-1269s1c1
Sequence:CCGGGCAAGAGGAAATGAAGGATATCTCGAGATATCCTTCATTTCCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172516.3-775s1c1
Sequence:CCGGCCTGTGATAACCTATGCACTTCTCGAGAAGTGCATAGGTTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172516.3-1953s1c1
Sequence:CCGGCCGGTCTTTACAGGATGTCTTCTCGAGAAGACATCCTGTAAAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172516.4-3319s21c1
Sequence:CCGGTCCAGATTGTATGGTCATAAACTCGAGTTTATGACCATACAATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172516.4-1383s21c1
Sequence:CCGGGCAAGAGGAAATGAAGGATATCTCGAGATATCCTTCATTTCCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172516.4-2717s21c1
Sequence:CCGGGCAAAGACCATCTCTGGAATACTCGAGTATTCCAGAGATGGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172516.4-889s21c1
Sequence:CCGGCCTGTGATAACCTATGCACTTCTCGAGAAGTGCATAGGTTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172516.4-2067s21c1
Sequence:CCGGCCGGTCTTTACAGGATGTCTTCTCGAGAAGACATCCTGTAAAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015375
VALIDATED
DSTYK MISSION shRNA Bacterial Glycerol Stock
dual serine/threonine and tyrosine protein kinase
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015375.1-2795s1c1
Sequence:CCGGGAGGACTAGATGATTCTACTTCTCGAGAAGTAGAATCATCTAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-2110s1c1
Sequence:CCGGGCTTTGGAATTTCACTATATGCTCGAGCATATAGTGAAATTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-931s1c1
Sequence:CCGGCCGCTTTATCGCCAGCTAATTCTCGAGAATTAGCTGGCGATAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-4029s1c1
Sequence:CCGGCCAACCCAATGCGAAGTATTTCTCGAGAAATACTTCGCATTGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-6063s1c1
Sequence:CCGGCATGAAAGAATGACCCTTATTCTCGAGAATAAGGGTCATTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-2395s1c1
Sequence:CCGGCGTGCCAAGATCACTGACTTACTCGAGTAAGTCAGTGATCTTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015375.1-1330s1c1
Sequence:CCGGGCTACTAACATGGAGTTTAAACTCGAGTTTAAACTCCATGTTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-2638s1c1
Sequence:CCGGCCAGAACGTCTTCCTGTGTTTCTCGAGAAACACAGGAAGACGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015375.1-2094s1c1
Sequence:CCGGGCACTGGAATGATCTGGCTTTCTCGAGAAAGCCAGATCATTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015375.1-884s1c1
Sequence:CCGGCGGAGATAATAGACTCCTCAACTCGAGTTGAGGAGTCTATTATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015375.2-2527s21c1
Sequence:GTACCGGCACAGGGAAGTACGATAATTCCTCGAGGAATTATCGTACTTCCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015375.2-956s21c1
Sequence:GTACCGGAGCGAAAGATCACCGCTTTATCTCGAGATAAAGCGGTGATCTTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015375.2-2377s21c1
Sequence:CCGGGGGACTTGTCCATCGTGATATCTCGAGATATCACGATGGACAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015375.2-1828s21c1
Sequence:CCGGATTCCGGACTCGGCTCAATAGCTCGAGCTATTGAGCCGAGTCCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015375.2-2147s21c1
Sequence:CCGGGCTTTGGAATTTCACTATATGCTCGAGCATATAGTGAAATTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015375.2-1480s21c1
Sequence:CCGGTAATCAGGCAGTGGCTAATAACTCGAGTTATTAGCCACTGCCTGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015375.2-3023s21c1
Sequence:CCGGGTTGAATGACTGAGCATATTCCTCGAGGAATATGCTCAGTCATTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015375
VALIDATED
DSTYK MISSION shRNA shRNA Plasmid DNA
dual serine/threonine and tyrosine protein kinase
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015375.1-2795s1c1
Sequence:CCGGGAGGACTAGATGATTCTACTTCTCGAGAAGTAGAATCATCTAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-2110s1c1
Sequence:CCGGGCTTTGGAATTTCACTATATGCTCGAGCATATAGTGAAATTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-931s1c1
Sequence:CCGGCCGCTTTATCGCCAGCTAATTCTCGAGAATTAGCTGGCGATAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-4029s1c1
Sequence:CCGGCCAACCCAATGCGAAGTATTTCTCGAGAAATACTTCGCATTGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-6063s1c1
Sequence:CCGGCATGAAAGAATGACCCTTATTCTCGAGAATAAGGGTCATTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-2395s1c1
Sequence:CCGGCGTGCCAAGATCACTGACTTACTCGAGTAAGTCAGTGATCTTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015375.1-1330s1c1
Sequence:CCGGGCTACTAACATGGAGTTTAAACTCGAGTTTAAACTCCATGTTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-2638s1c1
Sequence:CCGGCCAGAACGTCTTCCTGTGTTTCTCGAGAAACACAGGAAGACGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015375.1-2094s1c1
Sequence:CCGGGCACTGGAATGATCTGGCTTTCTCGAGAAAGCCAGATCATTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015375.1-884s1c1
Sequence:CCGGCGGAGATAATAGACTCCTCAACTCGAGTTGAGGAGTCTATTATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015375.2-2527s21c1
Sequence:GTACCGGCACAGGGAAGTACGATAATTCCTCGAGGAATTATCGTACTTCCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015375.2-956s21c1
Sequence:GTACCGGAGCGAAAGATCACCGCTTTATCTCGAGATAAAGCGGTGATCTTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015375.2-2377s21c1
Sequence:CCGGGGGACTTGTCCATCGTGATATCTCGAGATATCACGATGGACAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015375.2-1828s21c1
Sequence:CCGGATTCCGGACTCGGCTCAATAGCTCGAGCTATTGAGCCGAGTCCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015375.2-2147s21c1
Sequence:CCGGGCTTTGGAATTTCACTATATGCTCGAGCATATAGTGAAATTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015375.2-1480s21c1
Sequence:CCGGTAATCAGGCAGTGGCTAATAACTCGAGTTATTAGCCACTGCCTGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015375.2-3023s21c1
Sequence:CCGGGTTGAATGACTGAGCATATTCCTCGAGGAATATGCTCAGTCATTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015375
VALIDATED
DSTYK MISSION shRNA Lentiviral Transduction Particles
dual serine/threonine and tyrosine protein kinase
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015375.1-2795s1c1
Sequence:CCGGGAGGACTAGATGATTCTACTTCTCGAGAAGTAGAATCATCTAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-2110s1c1
Sequence:CCGGGCTTTGGAATTTCACTATATGCTCGAGCATATAGTGAAATTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-931s1c1
Sequence:CCGGCCGCTTTATCGCCAGCTAATTCTCGAGAATTAGCTGGCGATAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-4029s1c1
Sequence:CCGGCCAACCCAATGCGAAGTATTTCTCGAGAAATACTTCGCATTGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-6063s1c1
Sequence:CCGGCATGAAAGAATGACCCTTATTCTCGAGAATAAGGGTCATTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-2395s1c1
Sequence:CCGGCGTGCCAAGATCACTGACTTACTCGAGTAAGTCAGTGATCTTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015375.1-1330s1c1
Sequence:CCGGGCTACTAACATGGAGTTTAAACTCGAGTTTAAACTCCATGTTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015375.1-2638s1c1
Sequence:CCGGCCAGAACGTCTTCCTGTGTTTCTCGAGAAACACAGGAAGACGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015375.1-2094s1c1
Sequence:CCGGGCACTGGAATGATCTGGCTTTCTCGAGAAAGCCAGATCATTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015375.1-884s1c1
Sequence:CCGGCGGAGATAATAGACTCCTCAACTCGAGTTGAGGAGTCTATTATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015375.2-2527s21c1
Sequence:GTACCGGCACAGGGAAGTACGATAATTCCTCGAGGAATTATCGTACTTCCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015375.2-956s21c1
Sequence:GTACCGGAGCGAAAGATCACCGCTTTATCTCGAGATAAAGCGGTGATCTTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015375.2-2377s21c1
Sequence:CCGGGGGACTTGTCCATCGTGATATCTCGAGATATCACGATGGACAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015375.2-1828s21c1
Sequence:CCGGATTCCGGACTCGGCTCAATAGCTCGAGCTATTGAGCCGAGTCCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015375.2-2147s21c1
Sequence:CCGGGCTTTGGAATTTCACTATATGCTCGAGCATATAGTGAAATTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015375.2-1480s21c1
Sequence:CCGGTAATCAGGCAGTGGCTAATAACTCGAGTTATTAGCCACTGCCTGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015375.2-3023s21c1
Sequence:CCGGGTTGAATGACTGAGCATATTCCTCGAGGAATATGCTCAGTCATTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks