EMAIL THIS PAGE TO A FRIEND

DTD1

D-tyrosyl-tRNA deacylase 1

113 Gene Product Result for
Synonyms: C20orf88 DUEB HARS2 bA379J5.3 bA555E18.1 pqn-68
Gene ID:
Human(92675) Summary: The protein encoded by this gene is similar in sequence to histidyl-tRNA synthetase, which hydrolyzes D-tyrosyl-tRNA(Tyr) into D-tyrosine and free tRNA(Tyr). The encoded protein is found in the cytoplasm. [provided by RefSeq, Jul 2008]
Mouse(66044) D-tyrosyl-tRNA deacylase 1
Rat(362227) D-tyrosyl-tRNA deacylase 1
sheep(101122541) D-tyrosyl-tRNA deacylase 1
Domestic Rabbit(100351647) D-tyrosyl-tRNA deacylase 1
naked mole-rat(101720730) D-tyrosyl-tRNA deacylase 1
domestic guinea pig(100720371) D-tyrosyl-tRNA deacylase 1
Zebrafish(445046) D-tyrosyl-tRNA deacylase 1
dog(607771) D-tyrosyl-tRNA deacylase 1
domestic cat(101082142) D-tyrosyl-tRNA deacylase 1
cow(514493) D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae)
chicken(416726) D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080820 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080820 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080820 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025314 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025314 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025314 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038701 MISSION® esiRNA esiRNA human HARS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080820 Rosetta Predictions human pricing
NM_001108594 Rosetta Predictions rat pricing
NM_025314 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188792 predicted 381
2 SASI_Hs01_00188793 predicted 796
3 SASI_Hs01_00188794 predicted 678
4 SASI_Hs01_00188795 predicted 511
5 SASI_Hs01_00188796 predicted 500
6 SASI_Hs01_00188797 predicted 301
7 SASI_Hs01_00188798 predicted 285
8 SASI_Hs02_00362593 predicted 796
9 SASI_Hs02_00362594 predicted 682
10 SASI_Hs02_00362595 predicted 211
11 SASI_Hs01_00188791 predicted 845
12 SASI_Hs01_00188799 predicted 374
13 SASI_Hs01_00188800 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240179 predicted 482
2 SASI_Rn02_00240180 predicted 661
3 SASI_Rn02_00240181 predicted 464
4 SASI_Rn02_00240182 predicted 516
5 SASI_Rn02_00240183 predicted 639
6 SASI_Rn02_00240184 predicted 674
7 SASI_Rn02_00240185 predicted 245
8 SASI_Rn02_00240186 predicted 443
9 SASI_Rn02_00240187 predicted 414
10 SASI_Rn02_00240188 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132349 predicted 990
2 SASI_Mm01_00132350 predicted 486
3 SASI_Mm01_00132351 predicted 472
4 SASI_Mm01_00132352 predicted 922
5 SASI_Mm01_00132353 predicted 874
6 SASI_Mm01_00132354 predicted 252
7 SASI_Mm01_00132355 predicted 441
8 SASI_Mm01_00132357 predicted 254
9 SASI_Mm01_00132358 predicted 672
10 SASI_Mm02_00327950 predicted 407
11 SASI_Mm01_00132356 predicted 921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080820
VALIDATED
DTD1 MISSION shRNA Bacterial Glycerol Stock
D-tyrosyl-tRNA deacylase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080820.4-507s21c1
Sequence:CCGGACATACAGGCCGGAGCTTATCCTCGAGGATAAGCTCCGGCCTGTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080820.4-260s21c1
Sequence:CCGGTTCCCTGGAGGATACGCAGAACTCGAGTTCTGCGTATCCTCCAGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080820.4-547s21c1
Sequence:CCGGCCTACATGCAGGTGCACATTCCTCGAGGAATGTGCACCTGCATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080820.4-915s21c1
Sequence:CCGGAGAATTTGGGAACCTGAATAGCTCGAGCTATTCAGGTTCCCAAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080820.4-856s21c1
Sequence:CCGGTAAGCACCTACACTACTTTAACTCGAGTTAAAGTAGTGTAGGTGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080820.4-977s21c1
Sequence:CCGGTGTTGCTGTGGTGGAGTGATGCTCGAGCATCACTCCACCACAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080820.4-571s21c1
Sequence:CCGGATGATGGGCCTGTGACCATAGCTCGAGCTATGGTCACAGGCCCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_080820.3-411s1c1
Sequence:CCGGGCCTGATTTCCACCTAGCAATCTCGAGATTGCTAGGTGGAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_080820.3-399s1c1
Sequence:CCGGGAAGGGAAACAAGCCTGATTTCTCGAGAAATCAGGCTTGTTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_080820.3-284s1c1
Sequence:CCGGAGATTCTAAACCTGCGTGTATCTCGAGATACACGCAGGTTTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_080820.3-182s1c1
Sequence:CCGGCAGTTGGAGGAGAGCAGATTACTCGAGTAATCTGCTCTCCTCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_080820.3-674s1c1
Sequence:CCGGCTTCTGAATCAAGCAAGGAAACTCGAGTTTCCTTGCTTGATTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080820
VALIDATED
DTD1 MISSION shRNA shRNA Plasmid DNA
D-tyrosyl-tRNA deacylase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080820.4-507s21c1
Sequence:CCGGACATACAGGCCGGAGCTTATCCTCGAGGATAAGCTCCGGCCTGTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080820.4-260s21c1
Sequence:CCGGTTCCCTGGAGGATACGCAGAACTCGAGTTCTGCGTATCCTCCAGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080820.4-547s21c1
Sequence:CCGGCCTACATGCAGGTGCACATTCCTCGAGGAATGTGCACCTGCATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080820.4-915s21c1
Sequence:CCGGAGAATTTGGGAACCTGAATAGCTCGAGCTATTCAGGTTCCCAAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080820.4-856s21c1
Sequence:CCGGTAAGCACCTACACTACTTTAACTCGAGTTAAAGTAGTGTAGGTGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080820.4-977s21c1
Sequence:CCGGTGTTGCTGTGGTGGAGTGATGCTCGAGCATCACTCCACCACAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080820.4-571s21c1
Sequence:CCGGATGATGGGCCTGTGACCATAGCTCGAGCTATGGTCACAGGCCCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_080820.3-411s1c1
Sequence:CCGGGCCTGATTTCCACCTAGCAATCTCGAGATTGCTAGGTGGAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_080820.3-399s1c1
Sequence:CCGGGAAGGGAAACAAGCCTGATTTCTCGAGAAATCAGGCTTGTTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_080820.3-284s1c1
Sequence:CCGGAGATTCTAAACCTGCGTGTATCTCGAGATACACGCAGGTTTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_080820.3-182s1c1
Sequence:CCGGCAGTTGGAGGAGAGCAGATTACTCGAGTAATCTGCTCTCCTCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_080820.3-674s1c1
Sequence:CCGGCTTCTGAATCAAGCAAGGAAACTCGAGTTTCCTTGCTTGATTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080820
VALIDATED
DTD1 MISSION shRNA Lentiviral Transduction Particles
D-tyrosyl-tRNA deacylase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080820.4-507s21c1
Sequence:CCGGACATACAGGCCGGAGCTTATCCTCGAGGATAAGCTCCGGCCTGTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080820.4-260s21c1
Sequence:CCGGTTCCCTGGAGGATACGCAGAACTCGAGTTCTGCGTATCCTCCAGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080820.4-547s21c1
Sequence:CCGGCCTACATGCAGGTGCACATTCCTCGAGGAATGTGCACCTGCATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080820.4-915s21c1
Sequence:CCGGAGAATTTGGGAACCTGAATAGCTCGAGCTATTCAGGTTCCCAAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080820.4-856s21c1
Sequence:CCGGTAAGCACCTACACTACTTTAACTCGAGTTAAAGTAGTGTAGGTGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080820.4-977s21c1
Sequence:CCGGTGTTGCTGTGGTGGAGTGATGCTCGAGCATCACTCCACCACAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080820.4-571s21c1
Sequence:CCGGATGATGGGCCTGTGACCATAGCTCGAGCTATGGTCACAGGCCCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_080820.3-411s1c1
Sequence:CCGGGCCTGATTTCCACCTAGCAATCTCGAGATTGCTAGGTGGAAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_080820.3-399s1c1
Sequence:CCGGGAAGGGAAACAAGCCTGATTTCTCGAGAAATCAGGCTTGTTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_080820.3-284s1c1
Sequence:CCGGAGATTCTAAACCTGCGTGTATCTCGAGATACACGCAGGTTTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_080820.3-182s1c1
Sequence:CCGGCAGTTGGAGGAGAGCAGATTACTCGAGTAATCTGCTCTCCTCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_080820.3-674s1c1
Sequence:CCGGCTTCTGAATCAAGCAAGGAAACTCGAGTTTCCTTGCTTGATTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025314
VALIDATED
DTD1 MISSION shRNA Bacterial Glycerol Stock
D-tyrosyl-tRNA deacylase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025314.1-429s1c2
Sequence:CCGGCTTATCAGAGATGGCAAGTTTCTCGAGAAACTTGCCATCTCTGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025314.1-1025s1c1
Sequence:CCGGCCTAGCATCATCTGTCCTCATCTCGAGATGAGGACAGATGATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025314.1-600s1c1
Sequence:CCGGCCTTCTGAGTCAAGCAAAGAACTCGAGTTCTTTGCTTGACTCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025314.1-266s1c1
Sequence:CCGGCGTGATGGATAAGGAGTACGACTCGAGTCGTACTCCTTATCCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025314.1-158s1c1
Sequence:CCGGGCTGGGTATTTCCATGGAAGACTCGAGTCTTCCATGGAAATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025314
VALIDATED
DTD1 MISSION shRNA shRNA Plasmid DNA
D-tyrosyl-tRNA deacylase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025314.1-429s1c2
Sequence:CCGGCTTATCAGAGATGGCAAGTTTCTCGAGAAACTTGCCATCTCTGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025314.1-1025s1c1
Sequence:CCGGCCTAGCATCATCTGTCCTCATCTCGAGATGAGGACAGATGATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025314.1-600s1c1
Sequence:CCGGCCTTCTGAGTCAAGCAAAGAACTCGAGTTCTTTGCTTGACTCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025314.1-266s1c1
Sequence:CCGGCGTGATGGATAAGGAGTACGACTCGAGTCGTACTCCTTATCCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025314.1-158s1c1
Sequence:CCGGGCTGGGTATTTCCATGGAAGACTCGAGTCTTCCATGGAAATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025314
VALIDATED
DTD1 MISSION shRNA Lentiviral Transduction Particles
D-tyrosyl-tRNA deacylase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025314.1-429s1c2
Sequence:CCGGCTTATCAGAGATGGCAAGTTTCTCGAGAAACTTGCCATCTCTGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025314.1-1025s1c1
Sequence:CCGGCCTAGCATCATCTGTCCTCATCTCGAGATGAGGACAGATGATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025314.1-600s1c1
Sequence:CCGGCCTTCTGAGTCAAGCAAAGAACTCGAGTTCTTTGCTTGACTCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025314.1-266s1c1
Sequence:CCGGCGTGATGGATAAGGAGTACGACTCGAGTCGTACTCCTTATCCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025314.1-158s1c1
Sequence:CCGGGCTGGGTATTTCCATGGAAGACTCGAGTCTTCCATGGAAATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks