EMAIL THIS PAGE TO A FRIEND

DTD2

D-tyrosyl-tRNA deacylase 2 (putative)

80 Gene Product Result for
Synonyms: C14orf126
UniProtKB ID: Q96FN9, D3DS87
Gene ID:
Mouse(328092) D-tyrosyl-tRNA deacylase 2
Rat(366619) D-tyrosyl-tRNA deacylase 2 (putative)
Zebrafish(445510) D-tyrosyl-tRNA deacylase 2
domestic cat(101087489) D-tyrosyl-tRNA deacylase 2 (putative)
dog(609308) D-tyrosyl-tRNA deacylase 2 (putative)
domestic guinea pig(100714368) D-tyrosyl-tRNA deacylase 2 (putative)
naked mole-rat(101699177) D-tyrosyl-tRNA deacylase 2 (putative)
sheep(101116351) D-tyrosyl-tRNA deacylase 2 (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029545 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029545 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029545 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080664 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080664 Rosetta Predictions human pricing
NM_001108981 Rosetta Predictions rat pricing
NM_029545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231699 predicted 378
2 SASI_Hs01_00231701 predicted 415
3 SASI_Hs01_00231702 predicted 424
4 SASI_Hs01_00231703 predicted 381
5 SASI_Hs01_00231704 predicted 430
6 SASI_Hs01_00231705 predicted 408
7 SASI_Hs01_00231706 predicted 434
8 SASI_Hs01_00231707 predicted 435
9 SASI_Hs01_00231708 predicted 385
10 SASI_Hs02_00362426 predicted 423
11 SASI_Hs01_00231700 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243994 predicted 314
2 SASI_Rn02_00243995 predicted 197
3 SASI_Rn02_00243996 predicted 231
4 SASI_Rn02_00243997 predicted 196
5 SASI_Rn02_00243998 predicted 314
6 SASI_Rn02_00243999 predicted 234
7 SASI_Rn02_00244000 predicted 253
8 SASI_Rn02_00244001 predicted 240
9 SASI_Rn02_00244002 predicted 263
10 SASI_Rn02_00244003 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080591 predicted 401
2 SASI_Mm01_00080593 predicted 197
3 SASI_Mm01_00080594 predicted 207
4 SASI_Mm01_00080595 predicted 449
5 SASI_Mm01_00080596 predicted 712
6 SASI_Mm01_00080597 predicted 448
7 SASI_Mm01_00080598 predicted 973
8 SASI_Mm01_00080599 predicted 197
9 SASI_Mm01_00080600 predicted 453
10 SASI_Mm02_00335502 predicted 983
11 SASI_Mm01_00080592 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029545
DTD2 MISSION shRNA Bacterial Glycerol Stock
D-tyrosyl-tRNA deacylase 2 (putative)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029545.1-377s1c1
Sequence:CCGGCCAGTTTGTGAGTCTGTGTGACTCGAGTCACACAGACTCACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029545.1-139s1c1
Sequence:CCGGGATTGGTGATCTATGTGTGTTCTCGAGAACACACATAGATCACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029545.2-975s21c1
Sequence:CCGGGTCTGCGATTGGACGCTTTAGCTCGAGCTAAAGCGTCCAATCGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029545.2-323s21c1
Sequence:CCGGAGCATGCAGTACCACTCTAACCTCGAGGTTAGAGTGGTACTGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029545.2-132s21c1
Sequence:CCGGGGAGAGGATTGGTGATCTATGCTCGAGCATAGATCACCAATCCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029545.2-459s21c1
Sequence:CCGGACGGGAACAGGCAAGTGTTAACTCGAGTTAACACTTGCCTGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029545.2-194s21c1
Sequence:CCGGATGGTTAATACGCTGTTAAATCTCGAGATTTAACAGCGTATTAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029545
DTD2 MISSION shRNA shRNA Plasmid DNA
D-tyrosyl-tRNA deacylase 2 (putative)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029545.1-377s1c1
Sequence:CCGGCCAGTTTGTGAGTCTGTGTGACTCGAGTCACACAGACTCACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029545.1-139s1c1
Sequence:CCGGGATTGGTGATCTATGTGTGTTCTCGAGAACACACATAGATCACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029545.2-975s21c1
Sequence:CCGGGTCTGCGATTGGACGCTTTAGCTCGAGCTAAAGCGTCCAATCGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029545.2-323s21c1
Sequence:CCGGAGCATGCAGTACCACTCTAACCTCGAGGTTAGAGTGGTACTGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029545.2-132s21c1
Sequence:CCGGGGAGAGGATTGGTGATCTATGCTCGAGCATAGATCACCAATCCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029545.2-459s21c1
Sequence:CCGGACGGGAACAGGCAAGTGTTAACTCGAGTTAACACTTGCCTGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029545.2-194s21c1
Sequence:CCGGATGGTTAATACGCTGTTAAATCTCGAGATTTAACAGCGTATTAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029545
DTD2 MISSION shRNA Lentiviral Transduction Particles
D-tyrosyl-tRNA deacylase 2 (putative)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029545.1-377s1c1
Sequence:CCGGCCAGTTTGTGAGTCTGTGTGACTCGAGTCACACAGACTCACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029545.1-139s1c1
Sequence:CCGGGATTGGTGATCTATGTGTGTTCTCGAGAACACACATAGATCACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029545.2-975s21c1
Sequence:CCGGGTCTGCGATTGGACGCTTTAGCTCGAGCTAAAGCGTCCAATCGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029545.2-323s21c1
Sequence:CCGGAGCATGCAGTACCACTCTAACCTCGAGGTTAGAGTGGTACTGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029545.2-132s21c1
Sequence:CCGGGGAGAGGATTGGTGATCTATGCTCGAGCATAGATCACCAATCCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029545.2-459s21c1
Sequence:CCGGACGGGAACAGGCAAGTGTTAACTCGAGTTAACACTTGCCTGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029545.2-194s21c1
Sequence:CCGGATGGTTAATACGCTGTTAAATCTCGAGATTTAACAGCGTATTAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080664
VALIDATED
DTD2 MISSION shRNA Bacterial Glycerol Stock
D-tyrosyl-tRNA deacylase 2 (putative)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_080664.1-509s1c1
Sequence:CCGGCGGACCATTCACACACTTAATCTCGAGATTAAGTGTGTGAATGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_080664.1-337s1c1
Sequence:CCGGGAAACATGCAATATCACTCTACTCGAGTAGAGTGATATTGCATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080664.1-456s1c1
Sequence:CCGGGTAGTGGAACATGGCACTTATCTCGAGATAAGTGCCATGTTCCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_080664.1-261s1c1
Sequence:CCGGCATGTCTCTATATTGGATCTACTCGAGTAGATCCAATATAGAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_080664.1-426s1c1
Sequence:CCGGGCTAATAGCAAGTGTGCTGAACTCGAGTTCAGCACACTTGCTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080664
VALIDATED
DTD2 MISSION shRNA shRNA Plasmid DNA
D-tyrosyl-tRNA deacylase 2 (putative)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_080664.1-509s1c1
Sequence:CCGGCGGACCATTCACACACTTAATCTCGAGATTAAGTGTGTGAATGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_080664.1-337s1c1
Sequence:CCGGGAAACATGCAATATCACTCTACTCGAGTAGAGTGATATTGCATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080664.1-456s1c1
Sequence:CCGGGTAGTGGAACATGGCACTTATCTCGAGATAAGTGCCATGTTCCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_080664.1-261s1c1
Sequence:CCGGCATGTCTCTATATTGGATCTACTCGAGTAGATCCAATATAGAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_080664.1-426s1c1
Sequence:CCGGGCTAATAGCAAGTGTGCTGAACTCGAGTTCAGCACACTTGCTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080664
VALIDATED
DTD2 MISSION shRNA Lentiviral Transduction Particles
D-tyrosyl-tRNA deacylase 2 (putative)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_080664.1-509s1c1
Sequence:CCGGCGGACCATTCACACACTTAATCTCGAGATTAAGTGTGTGAATGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_080664.1-337s1c1
Sequence:CCGGGAAACATGCAATATCACTCTACTCGAGTAGAGTGATATTGCATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080664.1-456s1c1
Sequence:CCGGGTAGTGGAACATGGCACTTATCTCGAGATAAGTGCCATGTTCCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_080664.1-261s1c1
Sequence:CCGGCATGTCTCTATATTGGATCTACTCGAGTAGATCCAATATAGAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_080664.1-426s1c1
Sequence:CCGGGCTAATAGCAAGTGTGCTGAACTCGAGTTCAGCACACTTGCTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks