EMAIL THIS PAGE TO A FRIEND

DTHD1

death domain containing 1

46 Gene Product Result for
UniProtKB ID: Q6ZMT9, B2RXK4, B4E2N7
Gene ID:
Human(401124) Summary: This gene encodes a protein which contains a death domain. Death domain-containing proteins function in signaling pathways and formation of signaling complexes, as well as the apoptosis pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
sheep(101108656) death domain containing 1
Domestic Rabbit(100350314) death domain containing 1
naked mole-rat(101710319) death domain containing 1
domestic guinea pig(100722069) death domain containing 1
chicken(100858463) death domain containing 1
cow(100140203) death domain containing 1
Horse(100065254) death domain containing 1
domestic cat(101096726) death domain containing 1
dog(488839) death domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136536 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000451 MISSION® esiRNA esiRNA targeting human FLJ16686 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001713945 Rosetta Predictions human pricing
XM_379262 Rosetta Predictions human pricing
XM_940851 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00393964 predicted 1133
2 SASI_Hs02_00393965 predicted 944
3 SASI_Hs02_00393966 predicted 436
4 SASI_Hs02_00393967 predicted 499
5 SASI_Hs02_00393968 predicted 991
6 SASI_Hs02_00393969 predicted 1181
7 SASI_Hs02_00393970 predicted 525
8 SASI_Hs02_00393971 predicted 386
9 SASI_Hs02_00393972 predicted 1734
10 SASI_Hs02_00393973 predicted 2163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_379262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266732 predicted 1137
2 SASI_Hs02_00479817 predicted 533
3 SASI_Hs02_00479818 predicted 1326
4 SASI_Hs02_00479819 predicted 1259
5 SASI_Hs01_00266738 predicted 1177
6 SASI_Hs02_00479820 predicted 523
7 SASI_Hs01_00266739 predicted 1734
8 SASI_Hs02_00479821 predicted 1166
9 SASI_Hs02_00479822 predicted 2377
10 SASI_Hs02_00479823 predicted 1151
11 SASI_Hs01_00266733 predicted 592
12 SASI_Hs01_00266734 predicted 650
13 SASI_Hs01_00266735 predicted 600
14 SASI_Hs01_00266736 predicted 631
15 SASI_Hs01_00266737 predicted 1692
16 SASI_Hs01_00266740 predicted 1459
17 SASI_Hs01_00266741 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_940851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484439 predicted 1135
2 SASI_Hs02_00484440 predicted 948
3 SASI_Hs02_00484441 predicted 433
4 SASI_Hs02_00484442 predicted 490
5 SASI_Hs02_00484443 predicted 993
6 SASI_Hs02_00484444 predicted 1173
7 SASI_Hs02_00484445 predicted 528
8 SASI_Hs02_00484446 predicted 377
9 SASI_Hs02_00484447 predicted 1741
10 SASI_Hs02_00484448 predicted 2163
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136536
DTHD1 MISSION shRNA Bacterial Glycerol Stock
death domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136536.2-1788s21c1
Sequence:CCGGTGAATCAATCTCTCGTAATTACTCGAGTAATTACGAGAGATTGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136536.2-485s21c1
Sequence:CCGGCAACTAGAATGCCGGATAATACTCGAGTATTATCCGGCATTCTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136536.2-2313s21c1
Sequence:CCGGCTGGAAGTTTCCGAATGATATCTCGAGATATCATTCGGAAACTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136536.2-543s21c1
Sequence:CCGGAGTTAGTTAGCAACGTCATAACTCGAGTTATGACGTTGCTAACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136536.2-1138s21c1
Sequence:CCGGTAGGATTACACCTTCGTATTTCTCGAGAAATACGAAGGTGTAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136536
DTHD1 MISSION shRNA shRNA Plasmid DNA
death domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136536.2-1788s21c1
Sequence:CCGGTGAATCAATCTCTCGTAATTACTCGAGTAATTACGAGAGATTGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136536.2-485s21c1
Sequence:CCGGCAACTAGAATGCCGGATAATACTCGAGTATTATCCGGCATTCTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136536.2-2313s21c1
Sequence:CCGGCTGGAAGTTTCCGAATGATATCTCGAGATATCATTCGGAAACTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136536.2-543s21c1
Sequence:CCGGAGTTAGTTAGCAACGTCATAACTCGAGTTATGACGTTGCTAACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136536.2-1138s21c1
Sequence:CCGGTAGGATTACACCTTCGTATTTCTCGAGAAATACGAAGGTGTAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136536
DTHD1 MISSION shRNA Lentiviral Transduction Particles
death domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136536.2-1788s21c1
Sequence:CCGGTGAATCAATCTCTCGTAATTACTCGAGTAATTACGAGAGATTGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136536.2-485s21c1
Sequence:CCGGCAACTAGAATGCCGGATAATACTCGAGTATTATCCGGCATTCTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136536.2-2313s21c1
Sequence:CCGGCTGGAAGTTTCCGAATGATATCTCGAGATATCATTCGGAAACTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136536.2-543s21c1
Sequence:CCGGAGTTAGTTAGCAACGTCATAACTCGAGTTATGACGTTGCTAACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136536.2-1138s21c1
Sequence:CCGGTAGGATTACACCTTCGTATTTCTCGAGAAATACGAAGGTGTAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks