EMAIL THIS PAGE TO A FRIEND

DTL

denticleless E3 ubiquitin protein ligase homolog (Drosophila)

163 Gene Product Result for
Synonyms: CDT2 DCAF2 L2DTL RAMP
Gene ID:
Mouse(76843) denticleless homolog (Drosophila)
Rat(305073) denticleless E3 ubiquitin protein ligase homolog (Drosophila)
Zebrafish(192314) denticleless homolog (Drosophila)
cow(539953) denticleless E3 ubiquitin protein ligase homolog (Drosophila)
Horse(100054533) denticleless E3 ubiquitin protein ligase homolog (Drosophila)
domestic cat(101100689) denticleless E3 ubiquitin protein ligase homolog (Drosophila)
dog(490279) denticleless E3 ubiquitin protein ligase homolog (Drosophila)
chicken(421373) denticleless E3 ubiquitin protein ligase homolog (Drosophila)
domestic guinea pig(100723475) denticleless E3 ubiquitin protein ligase homolog (Drosophila)
naked mole-rat(101710833) denticleless E3 ubiquitin protein ligase homolog (Drosophila)
sheep(101117523) denticleless E3 ubiquitin protein ligase homolog (Drosophila)
Domestic Rabbit(100339258) denticleless E3 ubiquitin protein ligase homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016448 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029766 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029766 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029766 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016448 Rosetta Predictions human pricing
XM_001068900 Rosetta Predictions rat pricing
XM_223074 Rosetta Predictions rat pricing
NM_029766 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023613 predicted 1977
2 SASI_Hs01_00023614 predicted 1368
3 SASI_Hs02_00349482 predicted 352
4 SASI_Hs01_00023616 predicted 1050
5 SASI_Hs01_00023617 predicted 1180
6 SASI_Hs01_00023620 predicted 1027
7 SASI_Hs01_00023621 predicted 1505
8 SASI_Hs01_00023622 predicted 1126
9 SASI_Hs02_00349483 predicted 950
10 SASI_Hs02_00349484 predicted 758
11 SASI_Hs01_00023615 predicted 1242
12 SASI_Hs01_00023618 predicted 359
13 SASI_Hs01_00023619 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326224 predicted 2327
2 SASI_Rn02_00326225 predicted 1414
3 SASI_Rn02_00326226 predicted 232
4 SASI_Rn02_00326227 predicted 2306
5 SASI_Rn02_00326228 predicted 893
6 SASI_Rn02_00326229 predicted 1351
7 SASI_Rn02_00326230 predicted 971
8 SASI_Rn02_00326231 predicted 1038
9 SASI_Rn02_00326232 predicted 2333
10 SASI_Rn02_00326233 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381094 predicted 236
2 SASI_Rn02_00381095 predicted 342
3 SASI_Rn02_00381096 predicted 283
4 SASI_Rn02_00381097 predicted 214
5 SASI_Rn02_00381098 predicted 349
6 SASI_Rn02_00381099 predicted 269
7 SASI_Rn02_00381100 predicted 369
8 SASI_Rn02_00381101 predicted 336
9 SASI_Rn02_00381102 predicted 274
10 SASI_Rn02_00381103 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029766 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091292 predicted 870
2 SASI_Mm02_00335909 predicted 1374
3 SASI_Mm01_00091294 predicted 682
4 SASI_Mm01_00091295 predicted 1191
5 SASI_Mm01_00091296 predicted 1316
6 SASI_Mm01_00091297 predicted 308
7 SASI_Mm01_00091298 predicted 480
8 SASI_Mm02_00335910 predicted 1777
9 SASI_Mm01_00091299 predicted 372
10 SASI_Mm02_00335911 predicted 1381
11 SASI_Mm01_00091293 predicted 1006
12 SASI_Mm01_00091300 predicted 2303
13 SASI_Mm01_00091301 predicted 2265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016448
VALIDATED
DTL MISSION shRNA Bacterial Glycerol Stock
denticleless E3 ubiquitin protein ligase homolog (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_016448.2-2707s21c1
Sequence:CCGGCCGAGGATGAATGCTGTGTTTCTCGAGAAACACAGCATTCATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016448.2-636s21c1
Sequence:CCGGCCTGGTGAACTTAAACTTGTTCTCGAGAACAAGTTTAAGTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016448.2-492s21c1
Sequence:CCGGGCTCCCAATATGGAACATGTACTCGAGTACATGTTCCATATTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016448.2-1570s21c1
Sequence:CCGGGCCTAGTAACAGTAACGAGTACTCGAGTACTCGTTACTGTTACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016448.1-2495s1c1
Sequence:CCGGCCGAGGATGAATGCTGTGTTTCTCGAGAAACACAGCATTCATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016448.1-1358s1c1
Sequence:CCGGGCCTAGTAACAGTAACGAGTACTCGAGTACTCGTTACTGTTACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016448.1-424s1c1
Sequence:CCGGCCTGGTGAACTTAAACTTGTTCTCGAGAACAAGTTTAAGTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016448.1-425s1c1
Sequence:CCGGCTGGTGAACTTAAACTTGTTACTCGAGTAACAAGTTTAAGTTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016448.1-280s1c1
Sequence:CCGGGCTCCCAATATGGAACATGTACTCGAGTACATGTTCCATATTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016448
VALIDATED
DTL MISSION shRNA shRNA Plasmid DNA
denticleless E3 ubiquitin protein ligase homolog (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_016448.2-2707s21c1
Sequence:CCGGCCGAGGATGAATGCTGTGTTTCTCGAGAAACACAGCATTCATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016448.2-636s21c1
Sequence:CCGGCCTGGTGAACTTAAACTTGTTCTCGAGAACAAGTTTAAGTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016448.2-492s21c1
Sequence:CCGGGCTCCCAATATGGAACATGTACTCGAGTACATGTTCCATATTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016448.2-1570s21c1
Sequence:CCGGGCCTAGTAACAGTAACGAGTACTCGAGTACTCGTTACTGTTACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016448.1-2495s1c1
Sequence:CCGGCCGAGGATGAATGCTGTGTTTCTCGAGAAACACAGCATTCATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016448.1-1358s1c1
Sequence:CCGGGCCTAGTAACAGTAACGAGTACTCGAGTACTCGTTACTGTTACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016448.1-424s1c1
Sequence:CCGGCCTGGTGAACTTAAACTTGTTCTCGAGAACAAGTTTAAGTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016448.1-425s1c1
Sequence:CCGGCTGGTGAACTTAAACTTGTTACTCGAGTAACAAGTTTAAGTTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016448.1-280s1c1
Sequence:CCGGGCTCCCAATATGGAACATGTACTCGAGTACATGTTCCATATTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016448
VALIDATED
DTL MISSION shRNA Lentiviral Transduction Particles
denticleless E3 ubiquitin protein ligase homolog (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_016448.2-2707s21c1
Sequence:CCGGCCGAGGATGAATGCTGTGTTTCTCGAGAAACACAGCATTCATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016448.2-636s21c1
Sequence:CCGGCCTGGTGAACTTAAACTTGTTCTCGAGAACAAGTTTAAGTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016448.2-492s21c1
Sequence:CCGGGCTCCCAATATGGAACATGTACTCGAGTACATGTTCCATATTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016448.2-1570s21c1
Sequence:CCGGGCCTAGTAACAGTAACGAGTACTCGAGTACTCGTTACTGTTACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016448.1-2495s1c1
Sequence:CCGGCCGAGGATGAATGCTGTGTTTCTCGAGAAACACAGCATTCATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016448.1-1358s1c1
Sequence:CCGGGCCTAGTAACAGTAACGAGTACTCGAGTACTCGTTACTGTTACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016448.1-424s1c1
Sequence:CCGGCCTGGTGAACTTAAACTTGTTCTCGAGAACAAGTTTAAGTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016448.1-425s1c1
Sequence:CCGGCTGGTGAACTTAAACTTGTTACTCGAGTAACAAGTTTAAGTTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016448.1-280s1c1
Sequence:CCGGGCTCCCAATATGGAACATGTACTCGAGTACATGTTCCATATTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029766
VALIDATED
DTL MISSION shRNA Bacterial Glycerol Stock
denticleless E3 ubiquitin protein ligase homolog (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029766.2-1145s21c1
Sequence:CCGGTGATGAAGCTGCCTACATTTGCTCGAGCAAATGTAGGCAGCTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029766.2-1933s21c1
Sequence:CCGGACTCCGAGGGTCCTACCAAATCTCGAGATTTGGTAGGACCCTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029766.2-313s21c1
Sequence:CCGGCTCCCAGTATGGAGCATATATCTCGAGATATATGCTCCATACTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029766.2-182s21c1
Sequence:CCGGGAACGGGTGGTCTTCACATTACTCGAGTAATGTGAAGACCACCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029766.2-3145s21c1
Sequence:CCGGGCACCAGCTGTCTAGTATATTCTCGAGAATATACTAGACAGCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029766.1-1777s1c1
Sequence:CCGGGTCTGGAGAGTGTGAAACAAACTCGAGTTTGTTTCACACTCTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029766.1-840s1c1
Sequence:CCGGCGCAAGAATTACACTGCTTATCTCGAGATAAGCAGTGTAATTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029766.1-455s1c1
Sequence:CCGGCGGTGATCAGACAGCCAAATTCTCGAGAATTTGGCTGTCTGATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029766
VALIDATED
DTL MISSION shRNA shRNA Plasmid DNA
denticleless E3 ubiquitin protein ligase homolog (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029766.2-1145s21c1
Sequence:CCGGTGATGAAGCTGCCTACATTTGCTCGAGCAAATGTAGGCAGCTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029766.2-1933s21c1
Sequence:CCGGACTCCGAGGGTCCTACCAAATCTCGAGATTTGGTAGGACCCTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029766.2-313s21c1
Sequence:CCGGCTCCCAGTATGGAGCATATATCTCGAGATATATGCTCCATACTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029766.2-182s21c1
Sequence:CCGGGAACGGGTGGTCTTCACATTACTCGAGTAATGTGAAGACCACCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029766.2-3145s21c1
Sequence:CCGGGCACCAGCTGTCTAGTATATTCTCGAGAATATACTAGACAGCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029766.1-1777s1c1
Sequence:CCGGGTCTGGAGAGTGTGAAACAAACTCGAGTTTGTTTCACACTCTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029766.1-840s1c1
Sequence:CCGGCGCAAGAATTACACTGCTTATCTCGAGATAAGCAGTGTAATTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029766.1-455s1c1
Sequence:CCGGCGGTGATCAGACAGCCAAATTCTCGAGAATTTGGCTGTCTGATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029766
VALIDATED
DTL MISSION shRNA Lentiviral Transduction Particles
denticleless E3 ubiquitin protein ligase homolog (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029766.2-1145s21c1
Sequence:CCGGTGATGAAGCTGCCTACATTTGCTCGAGCAAATGTAGGCAGCTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029766.2-1933s21c1
Sequence:CCGGACTCCGAGGGTCCTACCAAATCTCGAGATTTGGTAGGACCCTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029766.2-313s21c1
Sequence:CCGGCTCCCAGTATGGAGCATATATCTCGAGATATATGCTCCATACTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029766.2-182s21c1
Sequence:CCGGGAACGGGTGGTCTTCACATTACTCGAGTAATGTGAAGACCACCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029766.2-3145s21c1
Sequence:CCGGGCACCAGCTGTCTAGTATATTCTCGAGAATATACTAGACAGCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029766.1-1777s1c1
Sequence:CCGGGTCTGGAGAGTGTGAAACAAACTCGAGTTTGTTTCACACTCTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029766.1-840s1c1
Sequence:CCGGCGCAAGAATTACACTGCTTATCTCGAGATAAGCAGTGTAATTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029766.1-455s1c1
Sequence:CCGGCGGTGATCAGACAGCCAAATTCTCGAGAATTTGGCTGTCTGATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks