EMAIL THIS PAGE TO A FRIEND

DTNA

dystrobrevin, alpha

447 Gene Product Result for
Synonyms: D18S892E DRP3 DTN DTN-A LVNC1
Gene ID:
Human(1837) Summary: The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(13527) dystrobrevin alpha
Rat(307548) dystrobrevin, alpha
Domestic Rabbit(100351412) dystrobrevin, alpha
naked mole-rat(101702677) dystrobrevin, alpha
domestic guinea pig(100620061) dystrobrevin alpha
Zebrafish(794932) dystrobrevin, alpha
chicken(421104) dystrobrevin, alpha
cow(541153) dystrobrevin, alpha
Horse(100052566) dystrobrevin, alpha
domestic cat(101090394) dystrobrevin, alpha
dog(490488) dystrobrevin, alpha
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207650 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207650 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207650 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001390 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128175 Rosetta Predictions human pricing
NM_001390 Rosetta Predictions human pricing
NM_001391 Rosetta Predictions human pricing
NM_001392 Rosetta Predictions human pricing
NM_032975 Rosetta Predictions human pricing
NM_032978 Rosetta Predictions human pricing
NM_032979 Rosetta Predictions human pricing
NM_032980 Rosetta Predictions human pricing
NM_032981 Rosetta Predictions human pricing
XM_001054053 Rosetta Predictions rat pricing
XM_001054112 Rosetta Predictions rat pricing
XM_001054243 Rosetta Predictions rat pricing
XM_001054380 Rosetta Predictions rat pricing
XM_001054433 Rosetta Predictions rat pricing
XM_001054487 Rosetta Predictions rat pricing
XM_001054548 Rosetta Predictions rat pricing
XM_001054600 Rosetta Predictions rat pricing
XM_001054655 Rosetta Predictions rat pricing
XM_001054726 Rosetta Predictions rat pricing
XM_001054793 Rosetta Predictions rat pricing
XM_226109 Rosetta Predictions rat pricing
NM_010087 Rosetta Predictions mouse pricing
NM_207650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330726 predicted 1232
2 SASI_Hs02_00330727 predicted 504
3 SASI_Hs02_00330728 predicted 959
4 SASI_Hs02_00330729 predicted 824
5 SASI_Hs02_00330730 predicted 693
6 SASI_Hs02_00330731 predicted 1323
7 SASI_Hs02_00330732 predicted 1462
8 SASI_Hs02_00330733 predicted 844
9 SASI_Hs02_00330734 predicted 1363
10 SASI_Hs02_00330735 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331757 predicted 2215
2 SASI_Hs01_00080137 predicted 1713
3 SASI_Hs01_00080138 predicted 2077
4 SASI_Hs01_00080139 predicted 2055
5 SASI_Hs01_00080140 predicted 2510
6 SASI_Hs01_00080142 predicted 2104
7 SASI_Hs01_00080143 predicted 2523
8 SASI_Hs01_00080144 predicted 2299
9 SASI_Hs01_00080145 predicted 2124
10 SASI_Hs01_00080146 predicted 1890
11 SASI_Hs01_00080141 predicted 1820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227409 predicted 1938
2 SASI_Hs02_00331758 predicted 1712
3 SASI_Hs01_00227410 predicted 2050
4 SASI_Hs01_00227411 predicted 2361
5 SASI_Hs01_00227412 predicted 2168
6 SASI_Hs01_00227413 predicted 2321
7 SASI_Hs01_00227414 predicted 1886
8 SASI_Hs01_00227415 predicted 2343
9 SASI_Hs01_00227416 predicted 2290
10 SASI_Hs01_00227417 predicted 2423
11 SASI_Hs01_00227418 predicted 1917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147692 predicted 601
2 SASI_Hs01_00147693 predicted 892
3 SASI_Hs01_00147694 predicted 936
4 SASI_Hs01_00147695 predicted 805
5 SASI_Hs01_00147696 predicted 671
6 SASI_Hs02_00331759 predicted 948
7 SASI_Hs01_00147697 predicted 521
8 SASI_Hs01_00147699 predicted 1059
9 SASI_Hs01_00147700 predicted 658
10 SASI_Hs01_00147701 predicted 756
11 SASI_Hs01_00147698 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136456 predicted 602
2 SASI_Hs01_00136457 predicted 894
3 SASI_Hs01_00136458 predicted 932
4 SASI_Hs01_00136459 predicted 805
5 SASI_Hs01_00136460 predicted 675
6 SASI_Hs02_00360607 predicted 949
7 SASI_Hs01_00136461 predicted 527
8 SASI_Hs01_00136463 predicted 1056
9 SASI_Hs01_00136464 predicted 654
10 SASI_Hs01_00136465 predicted 753
11 SASI_Hs01_00136462 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090117 predicted 1856
2 SASI_Hs02_00360612 predicted 1635
3 SASI_Hs01_00090118 predicted 1960
4 SASI_Hs01_00090119 predicted 2280
5 SASI_Hs01_00090120 predicted 2080
6 SASI_Hs01_00090121 predicted 2248
7 SASI_Hs01_00090122 predicted 1804
8 SASI_Hs01_00090123 predicted 2267
9 SASI_Hs01_00090124 predicted 2204
10 SASI_Hs01_00090125 predicted 2333
11 SASI_Hs01_00090126 predicted 1833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152654 predicted 2076
2 SASI_Hs01_00152655 predicted 1623
3 SASI_Hs01_00152656 predicted 1947
4 SASI_Hs01_00152657 predicted 2260
5 SASI_Hs01_00152658 predicted 2190
6 SASI_Hs01_00152659 predicted 2190
7 SASI_Hs01_00152660 predicted 2265
8 SASI_Hs01_00152661 predicted 1554
9 SASI_Hs01_00152662 predicted 2021
10 SASI_Hs02_00360613 predicted 1741
11 SASI_Hs01_00152653 predicted 2085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360614 predicted 1267
2 SASI_Hs01_00214633 predicted 771
3 SASI_Hs01_00214634 predicted 1137
4 SASI_Hs01_00214635 predicted 1103
5 SASI_Hs01_00214636 predicted 1563
6 SASI_Hs01_00214638 predicted 1162
7 SASI_Hs01_00214639 predicted 1572
8 SASI_Hs01_00214640 predicted 1357
9 SASI_Hs01_00214641 predicted 1178
10 SASI_Hs01_00214642 predicted 942
11 SASI_Hs01_00214637 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117418 predicted 915
2 SASI_Hs02_00360615 predicted 689
3 SASI_Hs01_00117419 predicted 1018
4 SASI_Hs01_00117420 predicted 1333
5 SASI_Hs01_00117421 predicted 1139
6 SASI_Hs01_00117422 predicted 1297
7 SASI_Hs01_00117423 predicted 861
8 SASI_Hs01_00117424 predicted 1327
9 SASI_Hs01_00117425 predicted 1268
10 SASI_Hs01_00117426 predicted 1391
11 SASI_Hs01_00117427 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274507 predicted 760
2 SASI_Rn02_00274508 predicted 1565
3 SASI_Rn02_00274509 predicted 1312
4 SASI_Rn02_00274510 predicted 1582
5 SASI_Rn02_00274511 predicted 1791
6 SASI_Rn02_00274512 predicted 1181
7 SASI_Rn02_00274513 predicted 886
8 SASI_Rn02_00274514 predicted 1758
9 SASI_Rn02_00274515 predicted 1600
10 SASI_Rn02_00274516 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274788 predicted 764
2 SASI_Rn02_00274789 predicted 1628
3 SASI_Rn02_00274790 predicted 1184
4 SASI_Rn02_00274791 predicted 886
5 SASI_Rn02_00274792 predicted 1603
6 SASI_Rn02_00274793 predicted 1433
7 SASI_Rn02_00274794 predicted 1404
8 SASI_Rn02_00274795 predicted 1407
9 SASI_Rn02_00274796 predicted 1363
10 SASI_Rn02_00274797 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275204 predicted 607
2 SASI_Rn02_00275205 predicted 1413
3 SASI_Rn02_00275206 predicted 1158
4 SASI_Rn02_00275207 predicted 1430
5 SASI_Rn02_00275208 predicted 1641
6 SASI_Rn02_00275209 predicted 1023
7 SASI_Rn02_00275210 predicted 729
8 SASI_Rn02_00275211 predicted 1612
9 SASI_Rn02_00275212 predicted 1444
10 SASI_Rn02_00275213 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275628 predicted 685
2 SASI_Rn02_00275629 predicted 1895
3 SASI_Rn02_00275630 predicted 2458
4 SASI_Rn02_00275631 predicted 1722
5 SASI_Rn02_00275632 predicted 2502
6 SASI_Rn02_00275633 predicted 1549
7 SASI_Rn02_00275634 predicted 1099
8 SASI_Rn02_00275635 predicted 1519
9 SASI_Rn02_00275636 predicted 1357
10 SASI_Rn02_00275637 predicted 2131
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275745 predicted 771
2 SASI_Rn02_00275746 predicted 1988
3 SASI_Rn02_00275747 predicted 2549
4 SASI_Rn02_00275748 predicted 1813
5 SASI_Rn02_00275749 predicted 2595
6 SASI_Rn02_00275750 predicted 1643
7 SASI_Rn02_00275751 predicted 1188
8 SASI_Rn02_00275752 predicted 1610
9 SASI_Rn02_00275753 predicted 1448
10 SASI_Rn02_00275754 predicted 2224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275975 predicted 760
2 SASI_Rn02_00275976 predicted 1981
3 SASI_Rn02_00275977 predicted 2536
4 SASI_Rn02_00275978 predicted 1799
5 SASI_Rn02_00275979 predicted 2590
6 SASI_Rn02_00275980 predicted 1634
7 SASI_Rn02_00275981 predicted 1184
8 SASI_Rn02_00275982 predicted 1601
9 SASI_Rn02_00275983 predicted 1436
10 SASI_Rn02_00275984 predicted 2214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276223 predicted 1894
2 SASI_Rn02_00276224 predicted 1156
3 SASI_Rn02_00276225 predicted 2462
4 SASI_Rn02_00276226 predicted 1713
5 SASI_Rn02_00276227 predicted 2500
6 SASI_Rn02_00276228 predicted 1551
7 SASI_Rn02_00276229 predicted 1032
8 SASI_Rn02_00276230 predicted 1519
9 SASI_Rn02_00276231 predicted 1346
10 SASI_Rn02_00276232 predicted 2127
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276410 predicted 2000
2 SASI_Rn02_00276411 predicted 1428
3 SASI_Rn02_00276412 predicted 2560
4 SASI_Rn02_00276413 predicted 1440
5 SASI_Rn02_00276414 predicted 1818
6 SASI_Rn02_00276415 predicted 2611
7 SASI_Rn02_00276416 predicted 1646
8 SASI_Rn02_00276417 predicted 1025
9 SASI_Rn02_00276418 predicted 1620
10 SASI_Rn02_00276419 predicted 1454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276657 predicted 1821
2 SASI_Rn02_00276658 predicted 1152
3 SASI_Rn02_00276659 predicted 2375
4 SASI_Rn02_00276660 predicted 1639
5 SASI_Rn02_00276661 predicted 2424
6 SASI_Rn02_00276662 predicted 1467
7 SASI_Rn02_00276663 predicted 1023
8 SASI_Rn02_00276664 predicted 1440
9 SASI_Rn02_00276665 predicted 1272
10 SASI_Rn02_00276666 predicted 2048
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054726 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276959 predicted 2006
2 SASI_Rn02_00276960 predicted 1412
3 SASI_Rn02_00276961 predicted 1157
4 SASI_Rn02_00276962 predicted 2571
5 SASI_Rn02_00276963 predicted 1423
6 SASI_Rn02_00276964 predicted 2623
7 SASI_Rn02_00276965 predicted 1644
8 SASI_Rn02_00276966 predicted 1029
9 SASI_Rn02_00276967 predicted 1610
10 SASI_Rn02_00276968 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277266 predicted 611
2 SASI_Rn02_00277267 predicted 1825
3 SASI_Rn02_00277268 predicted 2390
4 SASI_Rn02_00277269 predicted 1646
5 SASI_Rn02_00277270 predicted 2435
6 SASI_Rn02_00277271 predicted 1475
7 SASI_Rn02_00277272 predicted 1026
8 SASI_Rn02_00277273 predicted 1447
9 SASI_Rn02_00277274 predicted 1286
10 SASI_Rn02_00277275 predicted 2062
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125991 predicted 457
2 SASI_Rn01_00125992 predicted 409
3 SASI_Rn01_00125993 predicted 1266
4 SASI_Rn01_00125994 predicted 1283
5 SASI_Rn01_00125995 predicted 1660
6 SASI_Rn01_00125996 predicted 1495
7 SASI_Rn01_00125997 predicted 868
8 SASI_Rn01_00125998 predicted 573
9 SASI_Rn01_00125999 predicted 1464
10 SASI_Rn01_00126000 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110032 predicted 758
2 SASI_Mm01_00110033 predicted 952
3 SASI_Mm01_00110034 predicted 772
4 SASI_Mm02_00317779 predicted 743
5 SASI_Mm01_00110036 predicted 833
6 SASI_Mm01_00110037 predicted 1094
7 SASI_Mm01_00110038 predicted 1059
8 SASI_Mm01_00110039 predicted 691
9 SASI_Mm02_00317780 predicted 480
10 SASI_Mm01_00110040 predicted 497
11 SASI_Mm01_00110035 predicted 1205
12 SASI_Mm01_00110041 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067549 predicted 757
2 SASI_Mm01_00067550 predicted 949
3 SASI_Mm01_00067551 predicted 767
4 SASI_Mm02_00352161 predicted 746
5 SASI_Mm01_00067553 predicted 837
6 SASI_Mm01_00067554 predicted 1085
7 SASI_Mm01_00067555 predicted 1055
8 SASI_Mm01_00067556 predicted 687
9 SASI_Mm02_00352162 predicted 481
10 SASI_Mm01_00067557 predicted 494
11 SASI_Mm01_00067552 predicted 1198
12 SASI_Mm01_00067558 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207650
VALIDATED
DTNA MISSION shRNA Bacterial Glycerol Stock
dystrobrevin, alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207650.1-883s1c1
Sequence:CCGGCCTGCTAAGAAGCTAACGAATCTCGAGATTCGTTAGCTTCTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207650.1-1631s1c1
Sequence:CCGGCGTTTGCACAAAGTTCGAGAACTCGAGTTCTCGAACTTTGTGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207650.1-882s1c1
Sequence:CCGGACCTGCTAAGAAGCTAACGAACTCGAGTTCGTTAGCTTCTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207650.1-481s1c1
Sequence:CCGGGTGATGGTATATGGAAGATATCTCGAGATATCTTCCATATACCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207650.1-120s1c1
Sequence:CCGGGCTGAGATTTGTGCAGAAGAACTCGAGTTCTTCTGCACAAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207650.3-1188s21c1
Sequence:CCGGGCACCAAATGAAGGAGTATACCTCGAGGTATACTCCTTCATTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_207650.3-2837s21c1
Sequence:CCGGGTTCAGTTTACAACGACAATACTCGAGTATTGTCGTTGTAAACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207650.3-811s21c1
Sequence:CCGGTCCAGTGGAGTGATGGTATATCTCGAGATATACCATCACTCCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_207650.3-771s21c1
Sequence:CCGGCATGGACAAGTTAAGATATATCTCGAGATATATCTTAACTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207650.3-2266s21c1
Sequence:CCGGCAACCCGAGGATGGCAATTATCTCGAGATAATTGCCATCCTCGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207650
VALIDATED
DTNA MISSION shRNA shRNA Plasmid DNA
dystrobrevin, alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207650.1-883s1c1
Sequence:CCGGCCTGCTAAGAAGCTAACGAATCTCGAGATTCGTTAGCTTCTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207650.1-1631s1c1
Sequence:CCGGCGTTTGCACAAAGTTCGAGAACTCGAGTTCTCGAACTTTGTGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207650.1-882s1c1
Sequence:CCGGACCTGCTAAGAAGCTAACGAACTCGAGTTCGTTAGCTTCTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207650.1-481s1c1
Sequence:CCGGGTGATGGTATATGGAAGATATCTCGAGATATCTTCCATATACCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207650.1-120s1c1
Sequence:CCGGGCTGAGATTTGTGCAGAAGAACTCGAGTTCTTCTGCACAAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207650.3-1188s21c1
Sequence:CCGGGCACCAAATGAAGGAGTATACCTCGAGGTATACTCCTTCATTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_207650.3-2837s21c1
Sequence:CCGGGTTCAGTTTACAACGACAATACTCGAGTATTGTCGTTGTAAACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207650.3-811s21c1
Sequence:CCGGTCCAGTGGAGTGATGGTATATCTCGAGATATACCATCACTCCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_207650.3-771s21c1
Sequence:CCGGCATGGACAAGTTAAGATATATCTCGAGATATATCTTAACTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207650.3-2266s21c1
Sequence:CCGGCAACCCGAGGATGGCAATTATCTCGAGATAATTGCCATCCTCGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207650
VALIDATED
DTNA MISSION shRNA Lentiviral Transduction Particles
dystrobrevin, alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207650.1-883s1c1
Sequence:CCGGCCTGCTAAGAAGCTAACGAATCTCGAGATTCGTTAGCTTCTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207650.1-1631s1c1
Sequence:CCGGCGTTTGCACAAAGTTCGAGAACTCGAGTTCTCGAACTTTGTGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207650.1-882s1c1
Sequence:CCGGACCTGCTAAGAAGCTAACGAACTCGAGTTCGTTAGCTTCTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207650.1-481s1c1
Sequence:CCGGGTGATGGTATATGGAAGATATCTCGAGATATCTTCCATATACCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207650.1-120s1c1
Sequence:CCGGGCTGAGATTTGTGCAGAAGAACTCGAGTTCTTCTGCACAAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207650.3-1188s21c1
Sequence:CCGGGCACCAAATGAAGGAGTATACCTCGAGGTATACTCCTTCATTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_207650.3-2837s21c1
Sequence:CCGGGTTCAGTTTACAACGACAATACTCGAGTATTGTCGTTGTAAACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207650.3-811s21c1
Sequence:CCGGTCCAGTGGAGTGATGGTATATCTCGAGATATACCATCACTCCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_207650.3-771s21c1
Sequence:CCGGCATGGACAAGTTAAGATATATCTCGAGATATATCTTAACTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207650.3-2266s21c1
Sequence:CCGGCAACCCGAGGATGGCAATTATCTCGAGATAATTGCCATCCTCGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001390
VALIDATED
DTNA MISSION shRNA Bacterial Glycerol Stock
dystrobrevin, alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001390.3-4474s1c1
Sequence:CCGGCCCTTGACATACTTAATCATACTCGAGTATGATTAAGTATGTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001390.3-2204s1c1
Sequence:CCGGCGGACTCAGTTTGAGGATCTTCTCGAGAAGATCCTCAAACTGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001390.3-1016s1c1
Sequence:CCGGCGATGCCAACAGTGTCACAATCTCGAGATTGTGACACTGTTGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001390.3-1130s1c1
Sequence:CCGGCCTGCTAAGAAGCTGACTAATCTCGAGATTAGTCAGCTTCTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001390.4-1390s21c1
Sequence:CCGGTTTCACCATCGATGCGAATAACTCGAGTTATTCGCATCGATGGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001390.4-1958s21c1
Sequence:CCGGCGGACTCAGTTTGAGGATCTTCTCGAGAAGATCCTCAAACTGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001390.4-1292s21c1
Sequence:CCGGGATGAAGAACACAGGCTAATTCTCGAGAATTAGCCTGTGTTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001390.4-884s21c1
Sequence:CCGGCCTGCTAAGAAGCTGACTAATCTCGAGATTAGTCAGCTTCTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001390.4-2424s21c1
Sequence:CCGGGATGTGTCCTGATGACTATAGCTCGAGCTATAGTCATCAGGACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001390
VALIDATED
DTNA MISSION shRNA shRNA Plasmid DNA
dystrobrevin, alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001390.3-4474s1c1
Sequence:CCGGCCCTTGACATACTTAATCATACTCGAGTATGATTAAGTATGTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001390.3-2204s1c1
Sequence:CCGGCGGACTCAGTTTGAGGATCTTCTCGAGAAGATCCTCAAACTGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001390.3-1016s1c1
Sequence:CCGGCGATGCCAACAGTGTCACAATCTCGAGATTGTGACACTGTTGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001390.3-1130s1c1
Sequence:CCGGCCTGCTAAGAAGCTGACTAATCTCGAGATTAGTCAGCTTCTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001390.4-1390s21c1
Sequence:CCGGTTTCACCATCGATGCGAATAACTCGAGTTATTCGCATCGATGGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001390.4-1958s21c1
Sequence:CCGGCGGACTCAGTTTGAGGATCTTCTCGAGAAGATCCTCAAACTGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001390.4-1292s21c1
Sequence:CCGGGATGAAGAACACAGGCTAATTCTCGAGAATTAGCCTGTGTTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001390.4-884s21c1
Sequence:CCGGCCTGCTAAGAAGCTGACTAATCTCGAGATTAGTCAGCTTCTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001390.4-2424s21c1
Sequence:CCGGGATGTGTCCTGATGACTATAGCTCGAGCTATAGTCATCAGGACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001390
VALIDATED
DTNA MISSION shRNA Lentiviral Transduction Particles
dystrobrevin, alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001390.3-4474s1c1
Sequence:CCGGCCCTTGACATACTTAATCATACTCGAGTATGATTAAGTATGTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001390.3-2204s1c1
Sequence:CCGGCGGACTCAGTTTGAGGATCTTCTCGAGAAGATCCTCAAACTGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001390.3-1016s1c1
Sequence:CCGGCGATGCCAACAGTGTCACAATCTCGAGATTGTGACACTGTTGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001390.3-1130s1c1
Sequence:CCGGCCTGCTAAGAAGCTGACTAATCTCGAGATTAGTCAGCTTCTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001390.4-1390s21c1
Sequence:CCGGTTTCACCATCGATGCGAATAACTCGAGTTATTCGCATCGATGGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001390.4-1958s21c1
Sequence:CCGGCGGACTCAGTTTGAGGATCTTCTCGAGAAGATCCTCAAACTGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001390.4-1292s21c1
Sequence:CCGGGATGAAGAACACAGGCTAATTCTCGAGAATTAGCCTGTGTTCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001390.4-884s21c1
Sequence:CCGGCCTGCTAAGAAGCTGACTAATCTCGAGATTAGTCAGCTTCTTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001390.4-2424s21c1
Sequence:CCGGGATGTGTCCTGATGACTATAGCTCGAGCTATAGTCATCAGGACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks