EMAIL THIS PAGE TO A FRIEND

DTNB

dystrobrevin, beta

145 Gene Product Result for
Gene ID:
Human(1838) Summary: This gene encodes dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and beta. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Dystrobrevin beta is thought to interact with syntrophin and the DP71 short form of dystrophin. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(13528) dystrobrevin, beta
Rat(362715) dystrobrevin, beta
chicken(421992) dystrobrevin, beta
domestic cat(101085711) dystrobrevin, beta
dog(482997) dystrobrevin, beta
Horse(100055834) dystrobrevin, beta
cow(534119) dystrobrevin, beta
domestic guinea pig(100721904) dystrobrevin, beta
naked mole-rat(101720491) dystrobrevin, beta
sheep(101109165) dystrobrevin, beta
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021907 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021907 Rosetta Predictions human pricing
NM_033147 Rosetta Predictions human pricing
NM_033148 Rosetta Predictions human pricing
NM_183360 Rosetta Predictions human pricing
NM_183361 Rosetta Predictions human pricing
NM_001012191 Rosetta Predictions rat pricing
XM_575997 Rosetta Predictions rat pricing
NM_007886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014685 predicted 444
2 SASI_Hs02_00355180 predicted 323
3 SASI_Hs01_00014686 predicted 382
4 SASI_Hs01_00014687 predicted 440
5 SASI_Hs01_00014689 predicted 532
6 SASI_Hs02_00355181 predicted 549
7 SASI_Hs01_00014691 predicted 790
8 SASI_Hs01_00014692 predicted 492
9 SASI_Hs01_00014693 predicted 401
10 SASI_Hs01_00014694 predicted 1100
11 SASI_Hs01_00014688 predicted 592
12 SASI_Hs01_00014690 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205341 predicted 439
2 SASI_Hs02_00360882 predicted 323
3 SASI_Hs01_00205342 predicted 386
4 SASI_Hs01_00205343 predicted 438
5 SASI_Hs01_00205345 predicted 535
6 SASI_Hs02_00360883 predicted 546
7 SASI_Hs01_00205347 predicted 782
8 SASI_Hs01_00205348 predicted 489
9 SASI_Hs01_00205349 predicted 403
10 SASI_Hs01_00205350 predicted 1094
11 SASI_Hs01_00205344 predicted 585
12 SASI_Hs01_00205346 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151939 predicted 443
2 SASI_Hs02_00360884 predicted 324
3 SASI_Hs01_00151940 predicted 386
4 SASI_Hs01_00151941 predicted 446
5 SASI_Hs01_00151943 predicted 530
6 SASI_Hs02_00360885 predicted 540
7 SASI_Hs01_00151945 predicted 787
8 SASI_Hs01_00151946 predicted 497
9 SASI_Hs01_00151947 predicted 400
10 SASI_Hs01_00151948 predicted 1099
11 SASI_Hs01_00151942 predicted 586
12 SASI_Hs01_00151944 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181001 predicted 448
2 SASI_Hs02_00371273 predicted 327
3 SASI_Hs01_00181002 predicted 387
4 SASI_Hs01_00181003 predicted 446
5 SASI_Hs01_00181005 predicted 529
6 SASI_Hs02_00371274 predicted 545
7 SASI_Hs01_00181007 predicted 788
8 SASI_Hs01_00181008 predicted 491
9 SASI_Hs01_00181009 predicted 403
10 SASI_Hs01_00181010 predicted 1096
11 SASI_Hs01_00181004 predicted 586
12 SASI_Hs01_00181006 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130636 predicted 439
2 SASI_Hs02_00371275 predicted 325
3 SASI_Hs01_00130637 predicted 383
4 SASI_Hs01_00130638 predicted 441
5 SASI_Hs01_00130640 predicted 532
6 SASI_Hs02_00371276 predicted 542
7 SASI_Hs01_00130642 predicted 785
8 SASI_Hs01_00130643 predicted 494
9 SASI_Hs01_00130644 predicted 399
10 SASI_Hs01_00130645 predicted 1095
11 SASI_Hs01_00130639 predicted 587
12 SASI_Hs01_00130641 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056674 predicted 1178
2 SASI_Rn01_00056675 predicted 1421
3 SASI_Rn01_00056676 predicted 420
4 SASI_Rn01_00056678 predicted 1831
5 SASI_Rn01_00056679 predicted 701
6 SASI_Rn01_00056680 predicted 756
7 SASI_Rn01_00056681 predicted 714
8 SASI_Rn01_00056682 predicted 392
9 SASI_Rn02_00200409 predicted 887
10 SASI_Rn02_00200410 predicted 1134
11 SASI_Rn01_00056673 predicted 831
12 SASI_Rn01_00056677 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174814 predicted 2229
2 SASI_Rn01_00174815 predicted 1258
3 SASI_Rn01_00174816 predicted 3167
4 SASI_Rn01_00174817 predicted 2710
5 SASI_Rn01_00174818 predicted 4506
6 SASI_Rn01_00174819 predicted 1552
7 SASI_Rn01_00174820 predicted 2113
8 SASI_Rn01_00174821 predicted 765
9 SASI_Rn01_00174822 predicted 3220
10 SASI_Rn01_00174823 predicted 1728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025638 predicted 1023
2 SASI_Mm02_00312673 predicted 256
3 SASI_Mm01_00025641 predicted 1861
4 SASI_Mm01_00025642 predicted 555
5 SASI_Mm01_00025643 predicted 1941
6 SASI_Mm01_00025644 predicted 209
7 SASI_Mm01_00025645 predicted 970
8 SASI_Mm01_00025647 predicted 1375
9 SASI_Mm02_00312674 predicted 1153
10 SASI_Mm02_00312675 predicted 292
11 SASI_Mm01_00025639 predicted 275
12 SASI_Mm01_00025640 predicted 1407
13 SASI_Mm01_00025646 predicted 599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021907
DTNB MISSION shRNA Bacterial Glycerol Stock
dystrobrevin, beta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021907.3-335s21c1
Sequence:CCGGGTCATACGACTATCAACTTACCTCGAGGTAAGTTGATAGTCGTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021907.3-1145s21c1
Sequence:CCGGCTGAGCCATGCAATTAGTAAACTCGAGTTTACTAATTGCATGGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021907.3-554s21c1
Sequence:CCGCATTAGTGTGGAACAATCTATCCTCGAGGATAGATTGTTCCACACTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021907.3-722s21c1
Sequence:CCGGTCCAATGGCTTAATGATATTTCTCGAGAAATATCATTAAGCCATTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021907.3-362s1c1
Sequence:CCGGGCCTGCAAATTACGATTTGTACTCGAGTACAAATCGTAATTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021907.3-850s1c1
Sequence:CCGGGCAGAGAAAGATAATGCTAAACTCGAGTTTAGCATTATCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021907.3-1454s1c1
Sequence:CCGGCACCGTCTTATAGCTCGCTATCTCGAGATAGCGAGCTATAAGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021907.3-393s1c1
Sequence:CCGGGCAACCTTCATCTTGTTGATACTCGAGTATCAACAAGATGAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021907.3-620s1c1
Sequence:CCGGCGAGGCAAGTTGACGGTATTTCTCGAGAAATACCGTCAACTTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021907
DTNB MISSION shRNA shRNA Plasmid DNA
dystrobrevin, beta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021907.3-335s21c1
Sequence:CCGGGTCATACGACTATCAACTTACCTCGAGGTAAGTTGATAGTCGTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021907.3-1145s21c1
Sequence:CCGGCTGAGCCATGCAATTAGTAAACTCGAGTTTACTAATTGCATGGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021907.3-554s21c1
Sequence:CCGCATTAGTGTGGAACAATCTATCCTCGAGGATAGATTGTTCCACACTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021907.3-722s21c1
Sequence:CCGGTCCAATGGCTTAATGATATTTCTCGAGAAATATCATTAAGCCATTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021907.3-362s1c1
Sequence:CCGGGCCTGCAAATTACGATTTGTACTCGAGTACAAATCGTAATTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021907.3-850s1c1
Sequence:CCGGGCAGAGAAAGATAATGCTAAACTCGAGTTTAGCATTATCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021907.3-1454s1c1
Sequence:CCGGCACCGTCTTATAGCTCGCTATCTCGAGATAGCGAGCTATAAGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021907.3-393s1c1
Sequence:CCGGGCAACCTTCATCTTGTTGATACTCGAGTATCAACAAGATGAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021907.3-620s1c1
Sequence:CCGGCGAGGCAAGTTGACGGTATTTCTCGAGAAATACCGTCAACTTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021907
DTNB MISSION shRNA Lentiviral Transduction Particles
dystrobrevin, beta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021907.3-335s21c1
Sequence:CCGGGTCATACGACTATCAACTTACCTCGAGGTAAGTTGATAGTCGTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021907.3-1145s21c1
Sequence:CCGGCTGAGCCATGCAATTAGTAAACTCGAGTTTACTAATTGCATGGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021907.3-554s21c1
Sequence:CCGCATTAGTGTGGAACAATCTATCCTCGAGGATAGATTGTTCCACACTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021907.3-722s21c1
Sequence:CCGGTCCAATGGCTTAATGATATTTCTCGAGAAATATCATTAAGCCATTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021907.3-362s1c1
Sequence:CCGGGCCTGCAAATTACGATTTGTACTCGAGTACAAATCGTAATTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021907.3-850s1c1
Sequence:CCGGGCAGAGAAAGATAATGCTAAACTCGAGTTTAGCATTATCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021907.3-1454s1c1
Sequence:CCGGCACCGTCTTATAGCTCGCTATCTCGAGATAGCGAGCTATAAGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021907.3-393s1c1
Sequence:CCGGGCAACCTTCATCTTGTTGATACTCGAGTATCAACAAGATGAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021907.3-620s1c1
Sequence:CCGGCGAGGCAAGTTGACGGTATTTCTCGAGAAATACCGTCAACTTGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007886
VALIDATED
DTNB MISSION shRNA Bacterial Glycerol Stock
dystrobrevin, beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007886.1-1321s21c1
Sequence:CCGGGATGAGGAACACCGGCTTATACTCGAGTATAAGCCGGTGTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007886.1-1131s21c1
Sequence:CCGGTCCTCGCCCTCTGACCAATATCTCGAGATATTGGTCAGAGGGCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007886.1-236s21c1
Sequence:CCGGCAGCTTGCAAGTTACGATTTGCTCGAGCAAATCGTAACTTGCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007886.1-2089s21c1
Sequence:CCGGGCACATTCCTGTCCGTCTTTCCTCGAGGAAAGACGGACAGGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007886.1-447s21c1
Sequence:CCGGCATCAGTCTCCTACTCAATTTCTCGAGAAATTGAGTAGGAGACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007886.1-2227s1c1
Sequence:CCGGGCATGTACTAGCATCCGCATTCTCGAGAATGCGGATGCTAGTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007886.1-384s1c1
Sequence:CCGGGTCCATCTACTATCAGTTGAACTCGAGTTCAACTGATAGTAGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007886.1-1940s1c1
Sequence:CCGGAGCTCCATTCAGGAGAGGTTACTCGAGTAACCTCTCCTGAATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007886.1-1025s1c1
Sequence:CCGGGCCATGCAATTAGTAAATCTTCTCGAGAAGATTTACTAATTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007886
VALIDATED
DTNB MISSION shRNA shRNA Plasmid DNA
dystrobrevin, beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007886.1-1321s21c1
Sequence:CCGGGATGAGGAACACCGGCTTATACTCGAGTATAAGCCGGTGTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007886.1-1131s21c1
Sequence:CCGGTCCTCGCCCTCTGACCAATATCTCGAGATATTGGTCAGAGGGCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007886.1-236s21c1
Sequence:CCGGCAGCTTGCAAGTTACGATTTGCTCGAGCAAATCGTAACTTGCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007886.1-2089s21c1
Sequence:CCGGGCACATTCCTGTCCGTCTTTCCTCGAGGAAAGACGGACAGGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007886.1-447s21c1
Sequence:CCGGCATCAGTCTCCTACTCAATTTCTCGAGAAATTGAGTAGGAGACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007886.1-2227s1c1
Sequence:CCGGGCATGTACTAGCATCCGCATTCTCGAGAATGCGGATGCTAGTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007886.1-384s1c1
Sequence:CCGGGTCCATCTACTATCAGTTGAACTCGAGTTCAACTGATAGTAGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007886.1-1940s1c1
Sequence:CCGGAGCTCCATTCAGGAGAGGTTACTCGAGTAACCTCTCCTGAATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007886.1-1025s1c1
Sequence:CCGGGCCATGCAATTAGTAAATCTTCTCGAGAAGATTTACTAATTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007886
VALIDATED
DTNB MISSION shRNA Lentiviral Transduction Particles
dystrobrevin, beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007886.1-1321s21c1
Sequence:CCGGGATGAGGAACACCGGCTTATACTCGAGTATAAGCCGGTGTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007886.1-1131s21c1
Sequence:CCGGTCCTCGCCCTCTGACCAATATCTCGAGATATTGGTCAGAGGGCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007886.1-236s21c1
Sequence:CCGGCAGCTTGCAAGTTACGATTTGCTCGAGCAAATCGTAACTTGCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007886.1-2089s21c1
Sequence:CCGGGCACATTCCTGTCCGTCTTTCCTCGAGGAAAGACGGACAGGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007886.1-447s21c1
Sequence:CCGGCATCAGTCTCCTACTCAATTTCTCGAGAAATTGAGTAGGAGACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007886.1-2227s1c1
Sequence:CCGGGCATGTACTAGCATCCGCATTCTCGAGAATGCGGATGCTAGTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007886.1-384s1c1
Sequence:CCGGGTCCATCTACTATCAGTTGAACTCGAGTTCAACTGATAGTAGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007886.1-1940s1c1
Sequence:CCGGAGCTCCATTCAGGAGAGGTTACTCGAGTAACCTCTCCTGAATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007886.1-1025s1c1
Sequence:CCGGGCCATGCAATTAGTAAATCTTCTCGAGAAGATTTACTAATTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks