EMAIL THIS PAGE TO A FRIEND

DTNBP1

dystrobrevin binding protein 1

Synonyms: BLOC1S8 DBND HPS7 My031 SDY
Gene ID:
Human(84062) Summary: This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. A similar protein in mouse is a component of a protein complex termed biogenesis of lysosome-related organelles complex 1 (BLOC-1), and binds to alpha- and beta-dystrobrevins, which are components of the dystrophin-associated protein complex (DPC). Mutations in this gene are associated with Hermansky-Pudlak syndrome type 7. This gene may also be associated with schizophrenia. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(94245) dystrobrevin binding protein 1
Rat(641528) dystrobrevin binding protein 1
chicken(420840) dystrobrevin binding protein 1
cow(506612) dystrobrevin binding protein 1
domestic cat(101093270) dystrobrevin binding protein 1
dog(610315) dystrobrevin binding protein 1
sheep(100145862) dystrobrevin binding protein 1
naked mole-rat(101713330) dystrobrevin binding protein 1
domestic guinea pig(100729346) dystrobrevin binding protein 1
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300674 Anti-DTNBP1 (C-term) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1300673 Anti-DTNBP1 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1401882 Anti-DTNBP1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA028053 Anti-DTNBP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunofluorescence, immunohistochemistry, western blot pricing
HPA029615 Anti-DTNBP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunofluorescence, immunohistochemistry pricing
HPA029616 Anti-DTNBP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab3 human
immunohistochemistry, western blot pricing
SAB4200486 Anti-Dysbindin (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, rat
immunofluorescence, immunoprecipitation, western blot pricing
SAB4200409 Anti-Dysbindin antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody rat, mouse, human
immunofluorescence, western blot pricing
SAB1401883 Monoclonal Anti-DTNBP1 antibody produced in mouse clone 1B4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032122 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058981 MISSION® esiRNA esiRNA human DTNBP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032122 Rosetta Predictions human pricing
NM_183040 Rosetta Predictions human pricing
NM_183041 Rosetta Predictions human pricing
NM_001037664 Rosetta Predictions rat pricing
NM_025772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053577 predicted 652
2 SASI_Hs01_00053578 predicted 581
3 SASI_Hs01_00053582 predicted 509
4 SASI_Hs01_00053583 predicted 668
5 SASI_Hs01_00053584 predicted 650
6 SASI_Hs01_00053585 predicted 564
7 SASI_Hs01_00053586 predicted 627
8 SASI_Hs02_00359327 predicted 519
9 SASI_Hs02_00359328 predicted 625
10 SASI_Hs02_00359329 predicted 522
11 SASI_Hs01_00053579 predicted 749
12 SASI_Hs01_00053580 predicted 628
13 SASI_Hs01_00053581 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102720 predicted 651
2 SASI_Hs01_00102721 predicted 581
3 SASI_Hs01_00102725 predicted 503
4 SASI_Hs01_00102726 predicted 666
5 SASI_Hs01_00102727 predicted 651
6 SASI_Hs01_00102728 predicted 563
7 SASI_Hs01_00102729 predicted 625
8 SASI_Hs02_00371183 predicted 518
9 SASI_Hs02_00371184 predicted 620
10 SASI_Hs02_00371185 predicted 515
11 SASI_Hs01_00102722 predicted 743
12 SASI_Hs01_00102723 predicted 636
13 SASI_Hs01_00102724 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011558 predicted 701
2 SASI_Hs01_00011559 predicted 622
3 SASI_Hs01_00011563 predicted 552
4 SASI_Hs01_00011564 predicted 711
5 SASI_Hs01_00011565 predicted 700
6 SASI_Hs01_00011566 predicted 608
7 SASI_Hs01_00011567 predicted 672
8 SASI_Hs02_00371186 predicted 561
9 SASI_Hs02_00371187 predicted 667
10 SASI_Hs02_00371188 predicted 567
11 SASI_Hs01_00011560 predicted 797
12 SASI_Hs01_00011561 predicted 679
13 SASI_Hs01_00011562 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048199 predicted 455
2 SASI_Rn01_00048201 predicted 244
3 SASI_Rn01_00048202 predicted 251
4 SASI_Rn01_00048203 predicted 1046
5 SASI_Rn01_00048204 predicted 605
6 SASI_Rn02_00204548 predicted 558
7 SASI_Rn01_00048205 predicted 270
8 SASI_Rn01_00048206 predicted 303
9 SASI_Rn01_00048207 predicted 781
10 SASI_Rn01_00048208 predicted 745
11 SASI_Rn01_00048200 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113255 predicted 474
2 SASI_Mm01_00113257 predicted 251
3 SASI_Mm01_00113258 predicted 896
4 SASI_Mm01_00113259 predicted 608
5 SASI_Mm01_00113260 predicted 470
6 SASI_Mm01_00113261 predicted 951
7 SASI_Mm01_00113262 predicted 246
8 SASI_Mm01_00113264 predicted 624
9 SASI_Mm02_00328973 predicted 804
10 SASI_Mm02_00328974 predicted 525
11 SASI_Mm01_00113256 predicted 789
12 SASI_Mm01_00113263 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025772
VALIDATED
DTNBP1 MISSION shRNA Bacterial Glycerol Stock
dystrobrevin binding protein 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025772.3-180s1c1
Sequence:CCGGGCTGAAGACTTTAAGTGATAACTCGAGTTATCACTTAAAGTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025772.3-957s1c1
Sequence:CCGGGAATGAAATGAGTCTTCAGATCTCGAGATCTGAAGACTCATTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025772.3-583s1c1
Sequence:CCGGCACCTGGAGAGCTACAAGAAACTCGAGTTTCTTGTAGCTCTCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025772.3-473s1c1
Sequence:CCGGGCCTGGCTCATTTAGAGACAACTCGAGTTGTCTCTAAATGAGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025772.3-619s1c1
Sequence:CCGGCTTGAAGCCTTCAAAGCTGAACTCGAGTTCAGCTTTGAAGGCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025772.3-626s1c1
Sequence:CCGGCCTTCAAAGCTGAACTCGATACTCGAGTATCGAGTTCAGCTTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025772.3-1104s1c1
Sequence:CCGGCACATTACACACTGACAGAAACTCGAGTTTCTGTCAGTGTGTAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025772.4-958s21c1
Sequence:CCGGGAATGAAATGAGTCTTCAGATCTCGAGATCTGAAGACTCATTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025772.4-1105s21c1
Sequence:CCGGCACATTACACACTGACAGAAACTCGAGTTTCTGTCAGTGTGTAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025772.4-272s1c1
Sequence:CCGGGAATTACTTAGCAGGTATGAGCTCGAGCTCATACCTGCTAAGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025772.4-474s21c1
Sequence:CCGGGCCTGGCTCATTTAGAGACAACTCGAGTTGTCTCTAAATGAGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025772.4-181s21c1
Sequence:CCGGGCTGAAGACTTTAAGTGATAACTCGAGTTATCACTTAAAGTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025772.4-627s21c1
Sequence:CCGGCCTTCAAAGCTGAACTCGATACTCGAGTATCGAGTTCAGCTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025772
VALIDATED
DTNBP1 MISSION shRNA shRNA Plasmid DNA
dystrobrevin binding protein 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025772.3-180s1c1
Sequence:CCGGGCTGAAGACTTTAAGTGATAACTCGAGTTATCACTTAAAGTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025772.3-957s1c1
Sequence:CCGGGAATGAAATGAGTCTTCAGATCTCGAGATCTGAAGACTCATTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025772.3-583s1c1
Sequence:CCGGCACCTGGAGAGCTACAAGAAACTCGAGTTTCTTGTAGCTCTCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025772.3-473s1c1
Sequence:CCGGGCCTGGCTCATTTAGAGACAACTCGAGTTGTCTCTAAATGAGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025772.3-619s1c1
Sequence:CCGGCTTGAAGCCTTCAAAGCTGAACTCGAGTTCAGCTTTGAAGGCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025772.3-626s1c1
Sequence:CCGGCCTTCAAAGCTGAACTCGATACTCGAGTATCGAGTTCAGCTTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025772.3-1104s1c1
Sequence:CCGGCACATTACACACTGACAGAAACTCGAGTTTCTGTCAGTGTGTAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025772.4-958s21c1
Sequence:CCGGGAATGAAATGAGTCTTCAGATCTCGAGATCTGAAGACTCATTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025772.4-1105s21c1
Sequence:CCGGCACATTACACACTGACAGAAACTCGAGTTTCTGTCAGTGTGTAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025772.4-272s1c1
Sequence:CCGGGAATTACTTAGCAGGTATGAGCTCGAGCTCATACCTGCTAAGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025772.4-474s21c1
Sequence:CCGGGCCTGGCTCATTTAGAGACAACTCGAGTTGTCTCTAAATGAGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025772.4-181s21c1
Sequence:CCGGGCTGAAGACTTTAAGTGATAACTCGAGTTATCACTTAAAGTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025772.4-627s21c1
Sequence:CCGGCCTTCAAAGCTGAACTCGATACTCGAGTATCGAGTTCAGCTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025772
VALIDATED
DTNBP1 MISSION shRNA Lentiviral Transduction Particles
dystrobrevin binding protein 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025772.3-180s1c1
Sequence:CCGGGCTGAAGACTTTAAGTGATAACTCGAGTTATCACTTAAAGTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025772.3-957s1c1
Sequence:CCGGGAATGAAATGAGTCTTCAGATCTCGAGATCTGAAGACTCATTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025772.3-583s1c1
Sequence:CCGGCACCTGGAGAGCTACAAGAAACTCGAGTTTCTTGTAGCTCTCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025772.3-473s1c1
Sequence:CCGGGCCTGGCTCATTTAGAGACAACTCGAGTTGTCTCTAAATGAGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025772.3-619s1c1
Sequence:CCGGCTTGAAGCCTTCAAAGCTGAACTCGAGTTCAGCTTTGAAGGCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025772.3-626s1c1
Sequence:CCGGCCTTCAAAGCTGAACTCGATACTCGAGTATCGAGTTCAGCTTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025772.3-1104s1c1
Sequence:CCGGCACATTACACACTGACAGAAACTCGAGTTTCTGTCAGTGTGTAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025772.4-958s21c1
Sequence:CCGGGAATGAAATGAGTCTTCAGATCTCGAGATCTGAAGACTCATTTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025772.4-1105s21c1
Sequence:CCGGCACATTACACACTGACAGAAACTCGAGTTTCTGTCAGTGTGTAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025772.4-272s1c1
Sequence:CCGGGAATTACTTAGCAGGTATGAGCTCGAGCTCATACCTGCTAAGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025772.4-474s21c1
Sequence:CCGGGCCTGGCTCATTTAGAGACAACTCGAGTTGTCTCTAAATGAGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025772.4-181s21c1
Sequence:CCGGGCTGAAGACTTTAAGTGATAACTCGAGTTATCACTTAAAGTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025772.4-627s21c1
Sequence:CCGGCCTTCAAAGCTGAACTCGATACTCGAGTATCGAGTTCAGCTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032122
VALIDATED
DTNBP1 MISSION shRNA Bacterial Glycerol Stock
dystrobrevin binding protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032122.3-1289s1c1
Sequence:CCGGACCTGGAAAGCCAGGTTGTTTCTCGAGAAACAACCTGGCTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032122.3-484s1c1
Sequence:CCGGCCAGCTTTAATCGCAGACTTACTCGAGTAAGTCTGCGATTAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032122.3-308s1c1
Sequence:CCGGCTGCTGGATTAGAATTACTTACTCGAGTAAGTAATTCTAATCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_032122.3-228s1c1
Sequence:CCGGGCTGAAGACTTTAAGTGACAACTCGAGTTGTCACTTAAAGTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032122.3-670s1c1
Sequence:CCGGGAAACCTTCAAAGCTGAACTACTCGAGTAGTTCAGCTTTGAAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032122.3-1207s21c1
Sequence:GTACCGGGGTGAGGACAGCGACTCTTAACTCGAGTTAAGAGTCGCTGTCCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_032122.3-890s21c1
Sequence:GTACCGGAGATGGACCTGATGGACATATCTCGAGATATGTCCATCAGGTCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032122.3-566s21c1
Sequence:GTACCGGTGCTGCATCTGGAAGACTTATCTCGAGATAAGTCTTCCAGATGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032122
VALIDATED
DTNBP1 MISSION shRNA shRNA Plasmid DNA
dystrobrevin binding protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032122.3-1289s1c1
Sequence:CCGGACCTGGAAAGCCAGGTTGTTTCTCGAGAAACAACCTGGCTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032122.3-484s1c1
Sequence:CCGGCCAGCTTTAATCGCAGACTTACTCGAGTAAGTCTGCGATTAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032122.3-308s1c1
Sequence:CCGGCTGCTGGATTAGAATTACTTACTCGAGTAAGTAATTCTAATCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_032122.3-228s1c1
Sequence:CCGGGCTGAAGACTTTAAGTGACAACTCGAGTTGTCACTTAAAGTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032122.3-670s1c1
Sequence:CCGGGAAACCTTCAAAGCTGAACTACTCGAGTAGTTCAGCTTTGAAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032122.3-1207s21c1
Sequence:GTACCGGGGTGAGGACAGCGACTCTTAACTCGAGTTAAGAGTCGCTGTCCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_032122.3-890s21c1
Sequence:GTACCGGAGATGGACCTGATGGACATATCTCGAGATATGTCCATCAGGTCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032122.3-566s21c1
Sequence:GTACCGGTGCTGCATCTGGAAGACTTATCTCGAGATAAGTCTTCCAGATGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032122
VALIDATED
DTNBP1 MISSION shRNA Lentiviral Transduction Particles
dystrobrevin binding protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032122.3-1289s1c1
Sequence:CCGGACCTGGAAAGCCAGGTTGTTTCTCGAGAAACAACCTGGCTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032122.3-484s1c1
Sequence:CCGGCCAGCTTTAATCGCAGACTTACTCGAGTAAGTCTGCGATTAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032122.3-308s1c1
Sequence:CCGGCTGCTGGATTAGAATTACTTACTCGAGTAAGTAATTCTAATCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_032122.3-228s1c1
Sequence:CCGGGCTGAAGACTTTAAGTGACAACTCGAGTTGTCACTTAAAGTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032122.3-670s1c1
Sequence:CCGGGAAACCTTCAAAGCTGAACTACTCGAGTAGTTCAGCTTTGAAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032122.3-1207s21c1
Sequence:GTACCGGGGTGAGGACAGCGACTCTTAACTCGAGTTAAGAGTCGCTGTCCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_032122.3-890s21c1
Sequence:GTACCGGAGATGGACCTGATGGACATATCTCGAGATATGTCCATCAGGTCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032122.3-566s21c1
Sequence:GTACCGGTGCTGCATCTGGAAGACTTATCTCGAGATAAGTCTTCCAGATGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks