EMAIL THIS PAGE TO A FRIEND

DTWD1

DTW domain containing 1

46 Gene Product Result for
UniProtKB ID: Q8N5C7, Q567Q3, Q8WVG9, Q9NRU6
Gene ID:
Mouse(69185) DTW domain containing 1
Rat(296119) DTW domain containing 1
Zebrafish(449778) DTW domain containing 1
chicken(430167) DTW domain containing 1
cow(540840) DTW domain containing 1
dog(100687990) DTW domain containing 1
domestic cat(101097321) DTW domain containing 1
domestic guinea pig(100719235) DTW domain containing 1
naked mole-rat(101713506) DTW domain containing 1
sheep(101108491) DTW domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026981 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026981 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026981 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020234 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020234 Rosetta Predictions human pricing
NM_001013921 Rosetta Predictions rat pricing
NM_026981 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164046 predicted 770
2 SASI_Hs01_00164047 predicted 873
3 SASI_Hs01_00164048 predicted 572
4 SASI_Hs01_00164049 predicted 879
5 SASI_Hs01_00164050 predicted 757
6 SASI_Hs01_00164051 predicted 954
7 SASI_Hs01_00164053 predicted 420
8 SASI_Hs01_00164054 predicted 231
9 SASI_Hs01_00164055 predicted 467
10 SASI_Hs02_00353189 predicted 406
11 SASI_Hs01_00164052 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013921 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064442 predicted 371
2 SASI_Rn01_00064443 predicted 689
3 SASI_Rn01_00064444 predicted 987
4 SASI_Rn01_00064445 predicted 474
5 SASI_Rn01_00064446 predicted 830
6 SASI_Rn01_00064447 predicted 616
7 SASI_Rn01_00064448 predicted 1234
8 SASI_Rn01_00064449 predicted 574
9 SASI_Rn01_00064450 predicted 367
10 SASI_Rn01_00064451 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026981 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176207 predicted 820
2 SASI_Mm01_00176208 predicted 459
3 SASI_Mm01_00176209 predicted 752
4 SASI_Mm01_00176210 predicted 360
5 SASI_Mm01_00176211 predicted 345
6 SASI_Mm01_00176212 predicted 1064
7 SASI_Mm01_00176213 predicted 375
8 SASI_Mm01_00176214 predicted 424
9 SASI_Mm01_00176216 predicted 599
10 SASI_Mm02_00331304 predicted 237
11 SASI_Mm01_00176215 predicted 971
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026981
VALIDATED
DTWD1 MISSION shRNA Bacterial Glycerol Stock
DTW domain containing 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026981.2-558s21c1
Sequence:CCGGCAGTCTATCTCAATAGAAGATCTCGAGATCTTCTATTGAGATAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026981.2-1108s21c1
Sequence:CCGGGTTATGCCCATGAGAGAACATCTCGAGATGTTCTCTCATGGGCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026981.2-1098s21c1
Sequence:CCGGGTAACCATGTGTTATGCCCATCTCGAGATGGGCATAACACATGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026981.2-882s21c1
Sequence:CCGGGCCATTTATTACTTCCTAGTACTCGAGTACTAGGAAGTAATAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026981.2-786s21c1
Sequence:CCGGCTTCGGGAGTTATTACAAGTTCTCGAGAACTTGTAATAACTCCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026981.1-166s1c1
Sequence:CCGGCACAAACCACTTCCATTGCTTCTCGAGAAGCAATGGAAGTGGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026981.1-356s1c1
Sequence:CCGGGCTTCCATTGAAGATTGATATCTCGAGATATCAATCTTCAATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026981.1-846s1c1
Sequence:CCGGGAAGCCATTTATTACTTCCTACTCGAGTAGGAAGTAATAAATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026981.1-1075s1c1
Sequence:CCGGGTTATGCCCATGAGAGAACATCTCGAGATGTTCTCTCATGGGCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026981.1-1065s1c1
Sequence:CCGGGTAACCATGTGTTATGCCCATCTCGAGATGGGCATAACACATGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026981.1-849s1c1
Sequence:CCGGGCCATTTATTACTTCCTAGTACTCGAGTACTAGGAAGTAATAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026981.1-753s1c1
Sequence:CCGGCTTCGGGAGTTATTACAAGTTCTCGAGAACTTGTAATAACTCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026981.1-525s1c1
Sequence:CCGGCAGTCTATCTCAATAGAAGATCTCGAGATCTTCTATTGAGATAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026981
VALIDATED
DTWD1 MISSION shRNA shRNA Plasmid DNA
DTW domain containing 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026981.2-558s21c1
Sequence:CCGGCAGTCTATCTCAATAGAAGATCTCGAGATCTTCTATTGAGATAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026981.2-1108s21c1
Sequence:CCGGGTTATGCCCATGAGAGAACATCTCGAGATGTTCTCTCATGGGCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026981.2-1098s21c1
Sequence:CCGGGTAACCATGTGTTATGCCCATCTCGAGATGGGCATAACACATGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026981.2-882s21c1
Sequence:CCGGGCCATTTATTACTTCCTAGTACTCGAGTACTAGGAAGTAATAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026981.2-786s21c1
Sequence:CCGGCTTCGGGAGTTATTACAAGTTCTCGAGAACTTGTAATAACTCCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026981.1-166s1c1
Sequence:CCGGCACAAACCACTTCCATTGCTTCTCGAGAAGCAATGGAAGTGGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026981.1-356s1c1
Sequence:CCGGGCTTCCATTGAAGATTGATATCTCGAGATATCAATCTTCAATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026981.1-846s1c1
Sequence:CCGGGAAGCCATTTATTACTTCCTACTCGAGTAGGAAGTAATAAATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026981.1-1075s1c1
Sequence:CCGGGTTATGCCCATGAGAGAACATCTCGAGATGTTCTCTCATGGGCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026981.1-1065s1c1
Sequence:CCGGGTAACCATGTGTTATGCCCATCTCGAGATGGGCATAACACATGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026981.1-849s1c1
Sequence:CCGGGCCATTTATTACTTCCTAGTACTCGAGTACTAGGAAGTAATAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026981.1-753s1c1
Sequence:CCGGCTTCGGGAGTTATTACAAGTTCTCGAGAACTTGTAATAACTCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026981.1-525s1c1
Sequence:CCGGCAGTCTATCTCAATAGAAGATCTCGAGATCTTCTATTGAGATAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026981
VALIDATED
DTWD1 MISSION shRNA Lentiviral Transduction Particles
DTW domain containing 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026981.2-558s21c1
Sequence:CCGGCAGTCTATCTCAATAGAAGATCTCGAGATCTTCTATTGAGATAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026981.2-1108s21c1
Sequence:CCGGGTTATGCCCATGAGAGAACATCTCGAGATGTTCTCTCATGGGCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026981.2-1098s21c1
Sequence:CCGGGTAACCATGTGTTATGCCCATCTCGAGATGGGCATAACACATGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026981.2-882s21c1
Sequence:CCGGGCCATTTATTACTTCCTAGTACTCGAGTACTAGGAAGTAATAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026981.2-786s21c1
Sequence:CCGGCTTCGGGAGTTATTACAAGTTCTCGAGAACTTGTAATAACTCCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026981.1-166s1c1
Sequence:CCGGCACAAACCACTTCCATTGCTTCTCGAGAAGCAATGGAAGTGGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026981.1-356s1c1
Sequence:CCGGGCTTCCATTGAAGATTGATATCTCGAGATATCAATCTTCAATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026981.1-846s1c1
Sequence:CCGGGAAGCCATTTATTACTTCCTACTCGAGTAGGAAGTAATAAATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026981.1-1075s1c1
Sequence:CCGGGTTATGCCCATGAGAGAACATCTCGAGATGTTCTCTCATGGGCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026981.1-1065s1c1
Sequence:CCGGGTAACCATGTGTTATGCCCATCTCGAGATGGGCATAACACATGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026981.1-849s1c1
Sequence:CCGGGCCATTTATTACTTCCTAGTACTCGAGTACTAGGAAGTAATAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026981.1-753s1c1
Sequence:CCGGCTTCGGGAGTTATTACAAGTTCTCGAGAACTTGTAATAACTCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026981.1-525s1c1
Sequence:CCGGCAGTCTATCTCAATAGAAGATCTCGAGATCTTCTATTGAGATAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020234
DTWD1 MISSION shRNA Bacterial Glycerol Stock
DTW domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000135971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020234.3-617s1c1
Sequence:CCGGGACCATGAAGTTGCACTCATTCTCGAGAATGAGTGCAACTTCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020234.3-512s1c1
Sequence:CCGGCCAAATGAAACAGATGGCAAACTCGAGTTTGCCATCTGTTTCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020234.3-1072s1c1
Sequence:CCGGCCAGTTGATAAAGAATGCCAACTCGAGTTGGCATTCTTTATCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020234.3-455s1c1
Sequence:CCGGCCTATTGAACAGATTCCACTTCTCGAGAAGTGGAATCTGTTCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020234.3-586s1c1
Sequence:CCGGGTATCCGTGTATTCCAGAATACTCGAGTATTCTGGAATACACGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020234.3-875s1c1
Sequence:CCGGCGACTTCAAGGGTTGTTACAACTCGAGTTGTAACAACCCTTGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020234.3-577s1c1
Sequence:CCGGCATTTACACGTATCCGTGTATCTCGAGATACACGGATACGTGTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020234.3-761s1c1
Sequence:CCGGGAAGAACAAGAGTTCTGTGATCTCGAGATCACAGAACTCTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020234.3-291s1c1
Sequence:CCGGCACAAACTACTTCCATAGCTTCTCGAGAAGCTATGGAAGTAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020234
DTWD1 MISSION shRNA shRNA Plasmid DNA
DTW domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000135971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020234.3-617s1c1
Sequence:CCGGGACCATGAAGTTGCACTCATTCTCGAGAATGAGTGCAACTTCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020234.3-512s1c1
Sequence:CCGGCCAAATGAAACAGATGGCAAACTCGAGTTTGCCATCTGTTTCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020234.3-1072s1c1
Sequence:CCGGCCAGTTGATAAAGAATGCCAACTCGAGTTGGCATTCTTTATCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020234.3-455s1c1
Sequence:CCGGCCTATTGAACAGATTCCACTTCTCGAGAAGTGGAATCTGTTCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020234.3-586s1c1
Sequence:CCGGGTATCCGTGTATTCCAGAATACTCGAGTATTCTGGAATACACGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020234.3-875s1c1
Sequence:CCGGCGACTTCAAGGGTTGTTACAACTCGAGTTGTAACAACCCTTGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020234.3-577s1c1
Sequence:CCGGCATTTACACGTATCCGTGTATCTCGAGATACACGGATACGTGTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020234.3-761s1c1
Sequence:CCGGGAAGAACAAGAGTTCTGTGATCTCGAGATCACAGAACTCTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020234.3-291s1c1
Sequence:CCGGCACAAACTACTTCCATAGCTTCTCGAGAAGCTATGGAAGTAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020234
DTWD1 MISSION shRNA Lentiviral Transduction Particles
DTW domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000135971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020234.3-617s1c1
Sequence:CCGGGACCATGAAGTTGCACTCATTCTCGAGAATGAGTGCAACTTCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020234.3-512s1c1
Sequence:CCGGCCAAATGAAACAGATGGCAAACTCGAGTTTGCCATCTGTTTCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020234.3-1072s1c1
Sequence:CCGGCCAGTTGATAAAGAATGCCAACTCGAGTTGGCATTCTTTATCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020234.3-455s1c1
Sequence:CCGGCCTATTGAACAGATTCCACTTCTCGAGAAGTGGAATCTGTTCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020234.3-586s1c1
Sequence:CCGGGTATCCGTGTATTCCAGAATACTCGAGTATTCTGGAATACACGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020234.3-875s1c1
Sequence:CCGGCGACTTCAAGGGTTGTTACAACTCGAGTTGTAACAACCCTTGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020234.3-577s1c1
Sequence:CCGGCATTTACACGTATCCGTGTATCTCGAGATACACGGATACGTGTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020234.3-761s1c1
Sequence:CCGGGAAGAACAAGAGTTCTGTGATCTCGAGATCACAGAACTCTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020234.3-291s1c1
Sequence:CCGGCACAAACTACTTCCATAGCTTCTCGAGAAGCTATGGAAGTAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks