EMAIL THIS PAGE TO A FRIEND

DTWD2

DTW domain containing 2

65 Gene Product Result for
UniProtKB ID: Q8NBA8
Gene ID:
Mouse(68857) DTW domain containing 2
Rat(361326) DTW domain containing 2
sheep(101115791) DTW domain containing 2
naked mole-rat(101717118) DTW domain containing 2
domestic guinea pig(100721261) DTW domain containing 2
chicken(427386) DTW domain containing 2
cow(613362) DTW domain containing 2
domestic cat(101080505) DTW domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173666 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173666 Rosetta Predictions human pricing
NM_001108431 Rosetta Predictions rat pricing
NM_026854 Rosetta Predictions mouse pricing
XM_355059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209357 predicted 459
2 SASI_Hs02_00368592 predicted 641
3 SASI_Hs01_00209361 predicted 501
4 SASI_Hs02_00368593 predicted 499
5 SASI_Hs01_00209362 predicted 540
6 SASI_Hs02_00368594 predicted 638
7 SASI_Hs01_00209363 predicted 292
8 SASI_Hs01_00209364 predicted 895
9 SASI_Hs01_00209365 predicted 618
10 SASI_Hs02_00368595 predicted 340
11 SASI_Hs01_00209356 predicted 652
12 SASI_Hs01_00209358 predicted 956
13 SASI_Hs01_00209359 predicted 1035
14 SASI_Hs01_00209360 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108431 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238569 predicted 916
2 SASI_Rn02_00238570 predicted 668
3 SASI_Rn02_00238571 predicted 853
4 SASI_Rn02_00238572 predicted 645
5 SASI_Rn02_00238573 predicted 1432
6 SASI_Rn02_00238574 predicted 521
7 SASI_Rn02_00238575 predicted 860
8 SASI_Rn02_00238576 predicted 551
9 SASI_Rn02_00238577 predicted 675
10 SASI_Rn02_00238578 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331053 predicted 681
2 SASI_Mm02_00331054 predicted 611
3 SASI_Mm02_00331055 predicted 621
4 SASI_Mm02_00331056 predicted 851
5 SASI_Mm02_00331057 predicted 655
6 SASI_Mm02_00331058 predicted 661
7 SASI_Mm02_00331059 predicted 257
8 SASI_Mm02_00331060 predicted 395
9 SASI_Mm02_00331061 predicted 430
10 SASI_Mm02_00331062 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235113 predicted 1946
2 SASI_Mm01_00235114 predicted 1137
3 SASI_Mm01_00235115 predicted 1142
4 SASI_Mm01_00235116 predicted 2115
5 SASI_Mm01_00235117 predicted 1914
6 SASI_Mm01_00235118 predicted 1920
7 SASI_Mm01_00235119 predicted 238
8 SASI_Mm01_00235120 predicted 1007
9 SASI_Mm01_00235121 predicted 285
10 SASI_Mm01_00235122 predicted 1522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173666
DTWD2 MISSION shRNA Bacterial Glycerol Stock
DTW domain containing 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173666.1-648s1c1
Sequence:CCGGGCATTTCTAGTCAGTATGTAACTCGAGTTACATACTGACTAGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173666.2-308s21c1
Sequence:CCGGTCTACCCACTTGTACATAATTCTCGAGAATTATGTACAAGTGGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173666.2-668s21c1
Sequence:CCGGATTCGGATGCAGCCGACTAATCTCGAGATTAGTCGGCTGCATCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173666.2-3836s21c1
Sequence:CCGGCTTAGTCATGACCAGTAATATCTCGAGATATTACTGGTCATGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173666.2-461s21c1
Sequence:CCGGTGCCGGAAGTCTGGTACATTACTCGAGTAATGTACCAGACTTCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173666.2-768s21c1
Sequence:CCGGTTCGCCCTCTTCAAGCTTTATCTCGAGATAAAGCTTGAAGAGGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173666
DTWD2 MISSION shRNA shRNA Plasmid DNA
DTW domain containing 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173666.1-648s1c1
Sequence:CCGGGCATTTCTAGTCAGTATGTAACTCGAGTTACATACTGACTAGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173666.2-308s21c1
Sequence:CCGGTCTACCCACTTGTACATAATTCTCGAGAATTATGTACAAGTGGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173666.2-668s21c1
Sequence:CCGGATTCGGATGCAGCCGACTAATCTCGAGATTAGTCGGCTGCATCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173666.2-3836s21c1
Sequence:CCGGCTTAGTCATGACCAGTAATATCTCGAGATATTACTGGTCATGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173666.2-461s21c1
Sequence:CCGGTGCCGGAAGTCTGGTACATTACTCGAGTAATGTACCAGACTTCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173666.2-768s21c1
Sequence:CCGGTTCGCCCTCTTCAAGCTTTATCTCGAGATAAAGCTTGAAGAGGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173666
DTWD2 MISSION shRNA Lentiviral Transduction Particles
DTW domain containing 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173666.1-648s1c1
Sequence:CCGGGCATTTCTAGTCAGTATGTAACTCGAGTTACATACTGACTAGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173666.2-308s21c1
Sequence:CCGGTCTACCCACTTGTACATAATTCTCGAGAATTATGTACAAGTGGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173666.2-668s21c1
Sequence:CCGGATTCGGATGCAGCCGACTAATCTCGAGATTAGTCGGCTGCATCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173666.2-3836s21c1
Sequence:CCGGCTTAGTCATGACCAGTAATATCTCGAGATATTACTGGTCATGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173666.2-461s21c1
Sequence:CCGGTGCCGGAAGTCTGGTACATTACTCGAGTAATGTACCAGACTTCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173666.2-768s21c1
Sequence:CCGGTTCGCCCTCTTCAAGCTTTATCTCGAGATAAAGCTTGAAGAGGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026854
DTWD2 MISSION shRNA Bacterial Glycerol Stock
DTW domain containing 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026854.2-464s21c1
Sequence:CCGGTGCCGGGACTCTGGTACATTACTCGAGTAATGTACCAGAGTCCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026854.2-821s21c1
Sequence:CCGGATTCGCCTCAGCAAGGAATATCTCGAGATATTCCTTGCTGAGGCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026854.2-648s21c1
Sequence:CCGGCTAGCGTTTGTAGTCAGTATGCTCGAGCATACTGACTACAAACGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026854.2-2190s21c1
Sequence:CCGGGAACTTGGCTGGTCCTAATTACTCGAGTAATTAGGACCAGCCAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026854
DTWD2 MISSION shRNA shRNA Plasmid DNA
DTW domain containing 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026854.2-464s21c1
Sequence:CCGGTGCCGGGACTCTGGTACATTACTCGAGTAATGTACCAGAGTCCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026854.2-821s21c1
Sequence:CCGGATTCGCCTCAGCAAGGAATATCTCGAGATATTCCTTGCTGAGGCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026854.2-648s21c1
Sequence:CCGGCTAGCGTTTGTAGTCAGTATGCTCGAGCATACTGACTACAAACGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026854.2-2190s21c1
Sequence:CCGGGAACTTGGCTGGTCCTAATTACTCGAGTAATTAGGACCAGCCAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026854
DTWD2 MISSION shRNA Lentiviral Transduction Particles
DTW domain containing 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026854.2-464s21c1
Sequence:CCGGTGCCGGGACTCTGGTACATTACTCGAGTAATGTACCAGAGTCCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026854.2-821s21c1
Sequence:CCGGATTCGCCTCAGCAAGGAATATCTCGAGATATTCCTTGCTGAGGCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026854.2-648s21c1
Sequence:CCGGCTAGCGTTTGTAGTCAGTATGCTCGAGCATACTGACTACAAACGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026854.2-2190s21c1
Sequence:CCGGGAACTTGGCTGGTCCTAATTACTCGAGTAATTAGGACCAGCCAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks