EMAIL THIS PAGE TO A FRIEND

DTX1

deltex homolog 1 (Drosophila)

90 Gene Product Result for
Synonyms: hDx-1
UniProtKB ID: Q86Y01, O60630, Q9BS04
Gene ID:
Human(1840) Summary: Studies in Drosophila have identified this gene as encoding a positive regulator of the Notch-signaling pathway. The human gene encodes a protein of unknown function; however, it may play a role in basic helix-loop-helix transcription factor activity. [provided by RefSeq, Jul 2008]
Mouse(14357) deltex 1 homolog (Drosophila)
Rat(687424) deltex homolog 1 (Drosophila)
cow(512873) deltex homolog 1 (Drosophila)
domestic cat(101088366) deltex homolog 1 (Drosophila)
dog(486276) deltex homolog 1 (Drosophila)
chicken(770657) deltex homolog 1 (Drosophila)
domestic guinea pig(100722682) deltex homolog 1 (Drosophila)
naked mole-rat(101698438) deltex homolog 1 (Drosophila)
sheep(101109123) deltex homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004416 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008052 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008052 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008052 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004416 Rosetta Predictions human pricing
XM_001076535 Rosetta Predictions rat pricing
XM_001076559 Rosetta Predictions rat pricing
NM_008052 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229748 predicted 1691
2 SASI_Hs01_00229749 predicted 1983
3 SASI_Hs01_00229750 predicted 533
4 SASI_Hs01_00229751 predicted 1505
5 SASI_Hs01_00229752 predicted 1997
6 SASI_Hs01_00229753 predicted 2472
7 SASI_Hs01_00229754 predicted 2242
8 SASI_Hs01_00229755 predicted 2115
9 SASI_Hs01_00229756 predicted 1509
10 SASI_Hs02_00337564 predicted 1903
11 SASI_Hs01_00229757 predicted 2465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353594 predicted 2262
2 SASI_Rn02_00353595 predicted 2369
3 SASI_Rn02_00353596 predicted 2226
4 SASI_Rn02_00353597 predicted 1892
5 SASI_Rn02_00353598 predicted 1254
6 SASI_Rn02_00353599 predicted 1285
7 SASI_Rn02_00353600 predicted 2123
8 SASI_Rn02_00353601 predicted 1545
9 SASI_Rn02_00353602 predicted 1819
10 SASI_Rn02_00353603 predicted 1671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353713 predicted 2520
2 SASI_Rn02_00353714 predicted 1885
3 SASI_Rn02_00353715 predicted 879
4 SASI_Rn02_00353716 predicted 1923
5 SASI_Rn02_00353717 predicted 2179
6 SASI_Rn02_00353718 predicted 2445
7 SASI_Rn02_00353719 predicted 2302
8 SASI_Rn02_00353720 predicted 682
9 SASI_Rn02_00353721 predicted 2270
10 SASI_Rn02_00353722 predicted 2273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046913 predicted 2084
2 SASI_Mm01_00046914 predicted 2229
3 SASI_Mm01_00046915 predicted 2112
4 SASI_Mm01_00046916 predicted 1075
5 SASI_Mm01_00046917 predicted 2039
6 SASI_Mm01_00046918 predicted 2430
7 SASI_Mm01_00046919 predicted 1960
8 SASI_Mm01_00046920 predicted 2152
9 SASI_Mm01_00046921 predicted 3081
10 SASI_Mm01_00046922 predicted 1014
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004416
DTX1 MISSION shRNA Bacterial Glycerol Stock
deltex homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004416.2-2125s21c1
Sequence:CCGGGACGCTAGCTACCTAGACAACCTCGAGGTTGTCTAGGTAGCTAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004416.2-1703s21c1
Sequence:CCGGTGTACTCCAATGGCAACAAGGCTCGAGCCTTGTTGCCATTGGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004416.2-1844s21c1
Sequence:CCGGAGACCATCCGCATCGTCTATGCTCGAGCATAGACGATGCGGATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004416.2-1513s21c1
Sequence:CCGGGAGGATGTGGTTCGAAGATACCTCGAGGTATCTTCGAACCACATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004416.2-3068s1c1
Sequence:CCGGGCAGAGAGTCAATTTCCCTTTCTCGAGAAAGGGAAATTGACTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004416.2-1938s1c1
Sequence:CCGGCCACTGCTATCTACCCAACAACTCGAGTTGTTGGGTAGATAGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004416.2-1292s1c1
Sequence:CCGGCGGTGAAGAACTTGAATGGTACTCGAGTACCATTCAAGTTCTTCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004416.2-795s1c1
Sequence:CCGGCAACAGCATGTCGCAGATGAACTCGAGTTCATCTGCGACATGCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004416.2-1476s1c1
Sequence:CCGGGACCAAGAAGAAGCACCTTAACTCGAGTTAAGGTGCTTCTTCTTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004416
DTX1 MISSION shRNA shRNA Plasmid DNA
deltex homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004416.2-2125s21c1
Sequence:CCGGGACGCTAGCTACCTAGACAACCTCGAGGTTGTCTAGGTAGCTAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004416.2-1703s21c1
Sequence:CCGGTGTACTCCAATGGCAACAAGGCTCGAGCCTTGTTGCCATTGGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004416.2-1844s21c1
Sequence:CCGGAGACCATCCGCATCGTCTATGCTCGAGCATAGACGATGCGGATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004416.2-1513s21c1
Sequence:CCGGGAGGATGTGGTTCGAAGATACCTCGAGGTATCTTCGAACCACATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004416.2-3068s1c1
Sequence:CCGGGCAGAGAGTCAATTTCCCTTTCTCGAGAAAGGGAAATTGACTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004416.2-1938s1c1
Sequence:CCGGCCACTGCTATCTACCCAACAACTCGAGTTGTTGGGTAGATAGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004416.2-1292s1c1
Sequence:CCGGCGGTGAAGAACTTGAATGGTACTCGAGTACCATTCAAGTTCTTCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004416.2-795s1c1
Sequence:CCGGCAACAGCATGTCGCAGATGAACTCGAGTTCATCTGCGACATGCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004416.2-1476s1c1
Sequence:CCGGGACCAAGAAGAAGCACCTTAACTCGAGTTAAGGTGCTTCTTCTTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004416
DTX1 MISSION shRNA Lentiviral Transduction Particles
deltex homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004416.2-2125s21c1
Sequence:CCGGGACGCTAGCTACCTAGACAACCTCGAGGTTGTCTAGGTAGCTAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004416.2-1703s21c1
Sequence:CCGGTGTACTCCAATGGCAACAAGGCTCGAGCCTTGTTGCCATTGGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004416.2-1844s21c1
Sequence:CCGGAGACCATCCGCATCGTCTATGCTCGAGCATAGACGATGCGGATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004416.2-1513s21c1
Sequence:CCGGGAGGATGTGGTTCGAAGATACCTCGAGGTATCTTCGAACCACATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004416.2-3068s1c1
Sequence:CCGGGCAGAGAGTCAATTTCCCTTTCTCGAGAAAGGGAAATTGACTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004416.2-1938s1c1
Sequence:CCGGCCACTGCTATCTACCCAACAACTCGAGTTGTTGGGTAGATAGCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004416.2-1292s1c1
Sequence:CCGGCGGTGAAGAACTTGAATGGTACTCGAGTACCATTCAAGTTCTTCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004416.2-795s1c1
Sequence:CCGGCAACAGCATGTCGCAGATGAACTCGAGTTCATCTGCGACATGCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004416.2-1476s1c1
Sequence:CCGGGACCAAGAAGAAGCACCTTAACTCGAGTTAAGGTGCTTCTTCTTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008052
DTX1 MISSION shRNA Bacterial Glycerol Stock
deltex homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008052.3-3142s21c1
Sequence:CCGGCTTGAGTCAAGCACGGGATAGCTCGAGCTATCCCGTGCTTGACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008052.3-2089s21c1
Sequence:CCGGTGATGAGGACTGTACCATTTGCTCGAGCAAATGGTACAGTCCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008052.3-2472s21c1
Sequence:CCGGACTGCTACCTACCCAACAATGCTCGAGCATTGTTGGGTAGGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008052.3-978s21c1
Sequence:CCGGTGTGCCACCACATCGAGAATGCTCGAGCATTCTCGATGTGGTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008052.3-2607s21c1
Sequence:CCGGTTCACCACAAGACGGAGTTTGCTCGAGCAAACTCCGTCTTGTGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008052.1-1185s1c1
Sequence:CCGGTGCCGCAAGACCAAGAAGAAACTCGAGTTTCTTCTTGGTCTTGCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008052.1-1729s1c1
Sequence:CCGGTCATCTTCACTATCGGAACATCTCGAGATGTTCCGATAGTGAAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008052.1-392s1c1
Sequence:CCGGCTACGACATGGACATCTGCATCTCGAGATGCAGATGTCCATGTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008052.1-1508s1c1
Sequence:CCGGGAAGATGGAGTTTCACCTCATCTCGAGATGAGGTGAAACTCCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008052.1-1841s1c1
Sequence:CCGGCGACGCCAGCTACCTAGACAACTCGAGTTGTCTAGGTAGCTGGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008052
DTX1 MISSION shRNA shRNA Plasmid DNA
deltex homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008052.3-3142s21c1
Sequence:CCGGCTTGAGTCAAGCACGGGATAGCTCGAGCTATCCCGTGCTTGACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008052.3-2089s21c1
Sequence:CCGGTGATGAGGACTGTACCATTTGCTCGAGCAAATGGTACAGTCCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008052.3-2472s21c1
Sequence:CCGGACTGCTACCTACCCAACAATGCTCGAGCATTGTTGGGTAGGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008052.3-978s21c1
Sequence:CCGGTGTGCCACCACATCGAGAATGCTCGAGCATTCTCGATGTGGTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008052.3-2607s21c1
Sequence:CCGGTTCACCACAAGACGGAGTTTGCTCGAGCAAACTCCGTCTTGTGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008052.1-1185s1c1
Sequence:CCGGTGCCGCAAGACCAAGAAGAAACTCGAGTTTCTTCTTGGTCTTGCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008052.1-1729s1c1
Sequence:CCGGTCATCTTCACTATCGGAACATCTCGAGATGTTCCGATAGTGAAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008052.1-392s1c1
Sequence:CCGGCTACGACATGGACATCTGCATCTCGAGATGCAGATGTCCATGTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008052.1-1508s1c1
Sequence:CCGGGAAGATGGAGTTTCACCTCATCTCGAGATGAGGTGAAACTCCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008052.1-1841s1c1
Sequence:CCGGCGACGCCAGCTACCTAGACAACTCGAGTTGTCTAGGTAGCTGGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008052
DTX1 MISSION shRNA Lentiviral Transduction Particles
deltex homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008052.3-3142s21c1
Sequence:CCGGCTTGAGTCAAGCACGGGATAGCTCGAGCTATCCCGTGCTTGACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008052.3-2089s21c1
Sequence:CCGGTGATGAGGACTGTACCATTTGCTCGAGCAAATGGTACAGTCCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008052.3-2472s21c1
Sequence:CCGGACTGCTACCTACCCAACAATGCTCGAGCATTGTTGGGTAGGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008052.3-978s21c1
Sequence:CCGGTGTGCCACCACATCGAGAATGCTCGAGCATTCTCGATGTGGTGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008052.3-2607s21c1
Sequence:CCGGTTCACCACAAGACGGAGTTTGCTCGAGCAAACTCCGTCTTGTGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008052.1-1185s1c1
Sequence:CCGGTGCCGCAAGACCAAGAAGAAACTCGAGTTTCTTCTTGGTCTTGCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008052.1-1729s1c1
Sequence:CCGGTCATCTTCACTATCGGAACATCTCGAGATGTTCCGATAGTGAAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008052.1-392s1c1
Sequence:CCGGCTACGACATGGACATCTGCATCTCGAGATGCAGATGTCCATGTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008052.1-1508s1c1
Sequence:CCGGGAAGATGGAGTTTCACCTCATCTCGAGATGAGGTGAAACTCCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008052.1-1841s1c1
Sequence:CCGGCGACGCCAGCTACCTAGACAACTCGAGTTGTCTAGGTAGCTGGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks