EMAIL THIS PAGE TO A FRIEND

DTX2

deltex homolog 2 (Drosophila)

112 Gene Product Result for
Synonyms: RNF58
UniProtKB ID: Q86UW9, Q6XM87, Q6XM88, Q96H69, Q9H890, Q9P200
Gene ID:
Human(113878) Summary: DTX2 functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]
Mouse(74198) deltex 2 homolog (Drosophila)
Rat(304591) deltex homolog 2 (Drosophila)
Goat(100861037) deltex homolog 2 (Drosophila)
sheep(101116532) deltex homolog 2 (Drosophila)
naked mole-rat(101717817) deltex homolog 2 (Drosophila)
domestic guinea pig(100726658) deltex homolog 2 (Drosophila)
chicken(417515) deltex homolog 2 (Drosophila)
cow(532767) deltex homolog 2 (Drosophila)
Horse(100060906) deltex homolog 2 (Drosophila)
domestic cat(101083896) deltex homolog 2 (Drosophila)
dog(479723) deltex homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408217 Anti-DTX2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV43285 Anti-DTX2 antibody produced in rabbit affinity isolated antibody mouse, human, horse, zebrafish, guinea pig, bovine, canine, rat, rabbit
western blot pricing
SAB1410186 Anti-DTX2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020892 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU052931 MISSION® esiRNA esiRNA targeting mouse Dtx2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102594 Rosetta Predictions human pricing
NM_001102595 Rosetta Predictions human pricing
NM_001102596 Rosetta Predictions human pricing
NM_020892 Rosetta Predictions human pricing
NM_001107157 Rosetta Predictions rat pricing
NM_023742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323290 predicted 1894
2 SASI_Hs02_00323291 predicted 1802
3 SASI_Hs02_00323292 predicted 2009
4 SASI_Hs02_00323293 predicted 1124
5 SASI_Hs02_00323294 predicted 1884
6 SASI_Hs02_00323295 predicted 1900
7 SASI_Hs02_00323296 predicted 912
8 SASI_Hs02_00323297 predicted 2183
9 SASI_Hs02_00323298 predicted 2391
10 SASI_Hs02_00323299 predicted 2008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323300 predicted 1730
2 SASI_Hs02_00323301 predicted 1636
3 SASI_Hs02_00323302 predicted 1848
4 SASI_Hs02_00323303 predicted 956
5 SASI_Hs02_00323304 predicted 1716
6 SASI_Hs02_00323305 predicted 1734
7 SASI_Hs02_00323306 predicted 752
8 SASI_Hs02_00323307 predicted 2020
9 SASI_Hs02_00323308 predicted 2229
10 SASI_Hs02_00323309 predicted 1838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323310 predicted 1319
2 SASI_Hs02_00323311 predicted 1219
3 SASI_Hs02_00323312 predicted 1431
4 SASI_Hs02_00323313 predicted 688
5 SASI_Hs02_00323314 predicted 1309
6 SASI_Hs02_00323315 predicted 1321
7 SASI_Hs02_00323316 predicted 484
8 SASI_Hs02_00323317 predicted 1605
9 SASI_Hs02_00323318 predicted 1812
10 SASI_Hs02_00323319 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354204 predicted 2018
2 SASI_Hs01_00103651 predicted 1913
3 SASI_Hs01_00103659 predicted 2126
4 SASI_Hs02_00354205 predicted 1240
5 SASI_Hs02_00354206 predicted 2001
6 SASI_Hs02_00354207 predicted 2016
7 SASI_Hs01_00103658 predicted 1031
8 SASI_Hs02_00354208 predicted 2309
9 SASI_Hs02_00354209 predicted 2514
10 SASI_Hs02_00354210 predicted 2122
11 SASI_Hs01_00103652 predicted 1203
12 SASI_Hs01_00103653 predicted 1793
13 SASI_Hs01_00103654 predicted 1630
14 SASI_Hs01_00103655 predicted 528
15 SASI_Hs01_00103656 predicted 1540
16 SASI_Hs01_00103657 predicted 2172
17 SASI_Hs01_00103660 predicted 1522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226065 predicted 929
2 SASI_Rn02_00226066 predicted 1598
3 SASI_Rn02_00226067 predicted 2424
4 SASI_Rn02_00226068 predicted 1013
5 SASI_Rn02_00226069 predicted 813
6 SASI_Rn02_00226070 predicted 1944
7 SASI_Rn02_00226071 predicted 1931
8 SASI_Rn02_00226072 predicted 1801
9 SASI_Rn02_00226073 predicted 906
10 SASI_Rn02_00226074 predicted 1897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327321 predicted 850
2 SASI_Mm01_00086011 predicted 1582
3 SASI_Mm01_00086013 predicted 1473
4 SASI_Mm01_00086014 predicted 1678
5 SASI_Mm01_00086015 predicted 1812
6 SASI_Mm01_00086016 predicted 1809
7 SASI_Mm01_00086017 predicted 1973
8 SASI_Mm01_00086018 predicted 790
9 SASI_Mm01_00086019 predicted 2235
10 SASI_Mm02_00327322 predicted 1536
11 SASI_Mm01_00086012 predicted 2259
12 SASI_Mm01_00086020 predicted 617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023742
VALIDATED
DTX2 MISSION shRNA Bacterial Glycerol Stock
deltex homolog 2 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023742.1-1824s1c1
Sequence:CCGGGTGGGACTATACTCATTGTTTCTCGAGAAACAATGAGTATAGTCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023742.1-1919s1c1
Sequence:CCGGCGGCAATGCTACCTGCCAGATCTCGAGATCTGGCAGGTAGCATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023742.1-872s1c1
Sequence:CCGGGTGACTTCAGACATCGCTGTTCTCGAGAACAGCGATGTCTGAAGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023742.1-445s1c1
Sequence:CCGGCTCCTTCATTGAGCAGCATTTCTCGAGAAATGCTGCTCAATGAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023742.1-1060s1c1
Sequence:CCGGCCCATACAATAAACCTTCACTCTCGAGAGTGAAGGTTTATTGTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023742.1-445s21c1
Sequence:CCGGCTCCTTCATTGAGCAGCATTTCTCGAGAAATGCTGCTCAATGAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023742.1-872s21c1
Sequence:CCGGGTGACTTCAGACATCGCTGTTCTCGAGAACAGCGATGTCTGAAGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023742.1-1824s21c1
Sequence:CCGGGTGGGACTATACTCATTGTTTCTCGAGAAACAATGAGTATAGTCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023742.1-1919s21c1
Sequence:CCGGCGGCAATGCTACCTGCCAGATCTCGAGATCTGGCAGGTAGCATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023742.1-1060s21c1
Sequence:CCGGCCCATACAATAAACCTTCACTCTCGAGAGTGAAGGTTTATTGTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023742
VALIDATED
DTX2 MISSION shRNA shRNA Plasmid DNA
deltex homolog 2 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023742.1-1824s1c1
Sequence:CCGGGTGGGACTATACTCATTGTTTCTCGAGAAACAATGAGTATAGTCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023742.1-1919s1c1
Sequence:CCGGCGGCAATGCTACCTGCCAGATCTCGAGATCTGGCAGGTAGCATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023742.1-872s1c1
Sequence:CCGGGTGACTTCAGACATCGCTGTTCTCGAGAACAGCGATGTCTGAAGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023742.1-445s1c1
Sequence:CCGGCTCCTTCATTGAGCAGCATTTCTCGAGAAATGCTGCTCAATGAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023742.1-1060s1c1
Sequence:CCGGCCCATACAATAAACCTTCACTCTCGAGAGTGAAGGTTTATTGTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023742.1-445s21c1
Sequence:CCGGCTCCTTCATTGAGCAGCATTTCTCGAGAAATGCTGCTCAATGAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023742.1-872s21c1
Sequence:CCGGGTGACTTCAGACATCGCTGTTCTCGAGAACAGCGATGTCTGAAGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023742.1-1824s21c1
Sequence:CCGGGTGGGACTATACTCATTGTTTCTCGAGAAACAATGAGTATAGTCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023742.1-1919s21c1
Sequence:CCGGCGGCAATGCTACCTGCCAGATCTCGAGATCTGGCAGGTAGCATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023742.1-1060s21c1
Sequence:CCGGCCCATACAATAAACCTTCACTCTCGAGAGTGAAGGTTTATTGTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023742
VALIDATED
DTX2 MISSION shRNA Lentiviral Transduction Particles
deltex homolog 2 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023742.1-1824s1c1
Sequence:CCGGGTGGGACTATACTCATTGTTTCTCGAGAAACAATGAGTATAGTCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023742.1-1919s1c1
Sequence:CCGGCGGCAATGCTACCTGCCAGATCTCGAGATCTGGCAGGTAGCATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023742.1-872s1c1
Sequence:CCGGGTGACTTCAGACATCGCTGTTCTCGAGAACAGCGATGTCTGAAGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023742.1-445s1c1
Sequence:CCGGCTCCTTCATTGAGCAGCATTTCTCGAGAAATGCTGCTCAATGAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023742.1-1060s1c1
Sequence:CCGGCCCATACAATAAACCTTCACTCTCGAGAGTGAAGGTTTATTGTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023742.1-445s21c1
Sequence:CCGGCTCCTTCATTGAGCAGCATTTCTCGAGAAATGCTGCTCAATGAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023742.1-872s21c1
Sequence:CCGGGTGACTTCAGACATCGCTGTTCTCGAGAACAGCGATGTCTGAAGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023742.1-1824s21c1
Sequence:CCGGGTGGGACTATACTCATTGTTTCTCGAGAAACAATGAGTATAGTCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023742.1-1919s21c1
Sequence:CCGGCGGCAATGCTACCTGCCAGATCTCGAGATCTGGCAGGTAGCATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023742.1-1060s21c1
Sequence:CCGGCCCATACAATAAACCTTCACTCTCGAGAGTGAAGGTTTATTGTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020892
VALIDATED
DTX2 MISSION shRNA Bacterial Glycerol Stock
deltex homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_020892.x-1890s1c1
Sequence:CCGGCGGCAATAAGGATGGAAGTCTCTCGAGAGACTTCCATCCTTATTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020892.x-1886s1c1
Sequence:CCGGGCAACGGCAATAAGGATGGAACTCGAGTTCCATCCTTATTGCCGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020892.x-2259s1c1
Sequence:CCGGCAAGACAGAGATGGACCGCAACTCGAGTTGCGGTCCATCTCTGTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020892.x-1518s1c1
Sequence:CCGGAGGCATGACGAGTGTTCTGATCTCGAGATCAGAACACTCGTCATGCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020892.2-1924s21c1
Sequence:CCGGCATGTACTGCAACGGCAATAACTCGAGTTATTGCCGTTGCAGTACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020892.2-2310s21c1
Sequence:CCGGCAGAGATGGACCGCAACATTACTCGAGTAATGTTGCGGTCCATCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020892.2-2636s21c1
Sequence:CCGGGCTTAGGATGCAGCTACCTCACTCGAGTGAGGTAGCTGCATCCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020892.2-1728s21c1
Sequence:CCGGCAGAGCCAGAGCAGGTCATAACTCGAGTTATGACCTGCTCTGGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020892.2-2065s21c1
Sequence:CCGGCGGGACCATCCTCATAGTTTACTCGAGTAAACTATGAGGATGGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020892
VALIDATED
DTX2 MISSION shRNA shRNA Plasmid DNA
deltex homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_020892.x-1890s1c1
Sequence:CCGGCGGCAATAAGGATGGAAGTCTCTCGAGAGACTTCCATCCTTATTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020892.x-1886s1c1
Sequence:CCGGGCAACGGCAATAAGGATGGAACTCGAGTTCCATCCTTATTGCCGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020892.x-2259s1c1
Sequence:CCGGCAAGACAGAGATGGACCGCAACTCGAGTTGCGGTCCATCTCTGTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020892.x-1518s1c1
Sequence:CCGGAGGCATGACGAGTGTTCTGATCTCGAGATCAGAACACTCGTCATGCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020892.2-1924s21c1
Sequence:CCGGCATGTACTGCAACGGCAATAACTCGAGTTATTGCCGTTGCAGTACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020892.2-2310s21c1
Sequence:CCGGCAGAGATGGACCGCAACATTACTCGAGTAATGTTGCGGTCCATCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020892.2-2636s21c1
Sequence:CCGGGCTTAGGATGCAGCTACCTCACTCGAGTGAGGTAGCTGCATCCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020892.2-1728s21c1
Sequence:CCGGCAGAGCCAGAGCAGGTCATAACTCGAGTTATGACCTGCTCTGGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020892.2-2065s21c1
Sequence:CCGGCGGGACCATCCTCATAGTTTACTCGAGTAAACTATGAGGATGGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020892
VALIDATED
DTX2 MISSION shRNA Lentiviral Transduction Particles
deltex homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_020892.x-1890s1c1
Sequence:CCGGCGGCAATAAGGATGGAAGTCTCTCGAGAGACTTCCATCCTTATTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020892.x-1886s1c1
Sequence:CCGGGCAACGGCAATAAGGATGGAACTCGAGTTCCATCCTTATTGCCGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020892.x-2259s1c1
Sequence:CCGGCAAGACAGAGATGGACCGCAACTCGAGTTGCGGTCCATCTCTGTCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020892.x-1518s1c1
Sequence:CCGGAGGCATGACGAGTGTTCTGATCTCGAGATCAGAACACTCGTCATGCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020892.2-1924s21c1
Sequence:CCGGCATGTACTGCAACGGCAATAACTCGAGTTATTGCCGTTGCAGTACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020892.2-2310s21c1
Sequence:CCGGCAGAGATGGACCGCAACATTACTCGAGTAATGTTGCGGTCCATCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020892.2-2636s21c1
Sequence:CCGGGCTTAGGATGCAGCTACCTCACTCGAGTGAGGTAGCTGCATCCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020892.2-1728s21c1
Sequence:CCGGCAGAGCCAGAGCAGGTCATAACTCGAGTTATGACCTGCTCTGGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020892.2-2065s21c1
Sequence:CCGGCGGGACCATCCTCATAGTTTACTCGAGTAAACTATGAGGATGGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)