EMAIL THIS PAGE TO A FRIEND

DTX3

deltex homolog 3 (Drosophila)

93 Gene Product Result for
Synonyms: RNF154
UniProtKB ID: Q8N9I9, Q53ZZ2, Q8NAU6, Q8NDS8
Gene ID:
Human(196403) Summary: DTX3 functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]
Mouse(80904) deltex 3 homolog (Drosophila)
Rat(500847) deltex homolog 3 (Drosophila)
dog(100687947) deltex homolog 3 (Drosophila)
domestic cat(101082071) deltex homolog 3 (Drosophila)
cow(524779) deltex homolog 3 (Drosophila)
naked mole-rat(101709686) deltex homolog 3 (Drosophila)
sheep(101118862) deltex homolog 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030714 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030714 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030714 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178502 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069031 MISSION® esiRNA esiRNA human DTX3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178502 Rosetta Predictions human pricing
XM_001055773 Rosetta Predictions rat pricing
XM_576239 Rosetta Predictions rat pricing
NM_030714 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213718 predicted 1757
2 SASI_Hs01_00213719 predicted 1355
3 SASI_Hs02_00369744 predicted 1346
4 SASI_Hs01_00213720 predicted 1646
5 SASI_Hs01_00213721 predicted 1174
6 SASI_Hs01_00213722 predicted 492
7 SASI_Hs01_00213723 predicted 1550
8 SASI_Hs02_00369745 predicted 1255
9 SASI_Hs01_00213725 predicted 468
10 SASI_Hs02_00369746 predicted 1040
11 SASI_Hs01_00213724 predicted 502
12 SASI_Hs01_00213726 predicted 1045
13 SASI_Hs01_00213727 predicted 1377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280954 predicted 498
2 SASI_Rn02_00280955 predicted 580
3 SASI_Rn02_00280956 predicted 524
4 SASI_Rn02_00280957 predicted 658
5 SASI_Rn02_00280958 predicted 494
6 SASI_Rn02_00280959 predicted 659
7 SASI_Rn02_00280960 predicted 586
8 SASI_Rn02_00280961 predicted 498
9 SASI_Rn02_00280962 predicted 1093
10 SASI_Rn02_00280963 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404927 predicted 1632
2 SASI_Rn02_00404928 predicted 986
3 SASI_Rn02_00404929 predicted 1017
4 SASI_Rn02_00404930 predicted 1701
5 SASI_Rn02_00404931 predicted 1154
6 SASI_Rn02_00404932 predicted 1083
7 SASI_Rn02_00404933 predicted 1674
8 SASI_Rn02_00404934 predicted 1677
9 SASI_Rn02_00404935 predicted 1637
10 SASI_Rn02_00404936 predicted 1641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081855 predicted 385
2 SASI_Mm01_00081856 predicted 1221
3 SASI_Mm01_00081857 predicted 1001
4 SASI_Mm01_00081858 predicted 1082
5 SASI_Mm01_00081859 predicted 1287
6 SASI_Mm01_00081860 predicted 1224
7 SASI_Mm01_00081861 predicted 1322
8 SASI_Mm01_00081862 predicted 1178
9 SASI_Mm02_00336902 predicted 455
10 SASI_Mm01_00081863 predicted 1230
11 SASI_Mm01_00081854 predicted 1028
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030714
VALIDATED
DTX3 MISSION shRNA Bacterial Glycerol Stock
deltex homolog 3 (Drosophila)
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1766s21c1
Sequence:CCGGATAACAGTAGTCCTACCTTAACTCGAGTTAAGGTAGGACTACTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1209s21c1
Sequence:CCGGACTACAGGGAGACCCAATGTCCTCGAGGACATTGGGTCTCCCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1715s21c1
Sequence:CCGGTCTCACCTTGGACTGATATTACTCGAGTAATATCAGTCCAAGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1019s21c1
Sequence:CCGGTGGCACCATTGTCATCCAATACTCGAGTATTGGATGACAATGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030714.2-445s21c1
Sequence:CCGGATCGGGTGTCCATCCTCATAGCTCGAGCTATGAGGATGGACACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-575s21c1
Sequence:CCGGAGAGGCAGAGAAAGAGCTAAACTCGAGTTTAGCTCTTTCTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1339s21c1
Sequence:CCGGAGGGTATCACAGACGACTGAGCTCGAGCTCAGTCGTCTGTGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1305s21c1
Sequence:CCGGTACCTGACTAGGGTGCAAGAGCTCGAGCTCTTGCACCCTAGTCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1155s21c1
Sequence:CCGGCTGTTCCGAAAGGCATTTGACCTCGAGGTCAAATGCCTTTCGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030714.2-1703s1c1
Sequence:CCGGCCCTGAATACTGTCTCACCTTCTCGAGAAGGTGAGACAGTATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_030714.2-1226s1c1
Sequence:CCGGTGTCATCACTTGGAACGACATCTCGAGATGTCGTTCCAAGTGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_030714.2-566s1c1
Sequence:CCGGGCTACTGAAAGAGGCAGAGAACTCGAGTTCTCTGCCTCTTTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030714.2-457s1c1
Sequence:CCGGTCCTCATAGATGGCGAGACTTCTCGAGAAGTCTCGCCATCTATGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030714.2-1007s1c1
Sequence:CCGGCTACGAGAAGTATGGCACCATCTCGAGATGGTGCCATACTTCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030714
VALIDATED
DTX3 MISSION shRNA shRNA Plasmid DNA
deltex homolog 3 (Drosophila)
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1766s21c1
Sequence:CCGGATAACAGTAGTCCTACCTTAACTCGAGTTAAGGTAGGACTACTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1209s21c1
Sequence:CCGGACTACAGGGAGACCCAATGTCCTCGAGGACATTGGGTCTCCCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1715s21c1
Sequence:CCGGTCTCACCTTGGACTGATATTACTCGAGTAATATCAGTCCAAGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1019s21c1
Sequence:CCGGTGGCACCATTGTCATCCAATACTCGAGTATTGGATGACAATGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030714.2-445s21c1
Sequence:CCGGATCGGGTGTCCATCCTCATAGCTCGAGCTATGAGGATGGACACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-575s21c1
Sequence:CCGGAGAGGCAGAGAAAGAGCTAAACTCGAGTTTAGCTCTTTCTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1339s21c1
Sequence:CCGGAGGGTATCACAGACGACTGAGCTCGAGCTCAGTCGTCTGTGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1305s21c1
Sequence:CCGGTACCTGACTAGGGTGCAAGAGCTCGAGCTCTTGCACCCTAGTCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1155s21c1
Sequence:CCGGCTGTTCCGAAAGGCATTTGACCTCGAGGTCAAATGCCTTTCGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030714.2-1703s1c1
Sequence:CCGGCCCTGAATACTGTCTCACCTTCTCGAGAAGGTGAGACAGTATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_030714.2-1226s1c1
Sequence:CCGGTGTCATCACTTGGAACGACATCTCGAGATGTCGTTCCAAGTGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_030714.2-566s1c1
Sequence:CCGGGCTACTGAAAGAGGCAGAGAACTCGAGTTCTCTGCCTCTTTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030714.2-457s1c1
Sequence:CCGGTCCTCATAGATGGCGAGACTTCTCGAGAAGTCTCGCCATCTATGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030714.2-1007s1c1
Sequence:CCGGCTACGAGAAGTATGGCACCATCTCGAGATGGTGCCATACTTCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030714
VALIDATED
DTX3 MISSION shRNA Lentiviral Transduction Particles
deltex homolog 3 (Drosophila)
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1766s21c1
Sequence:CCGGATAACAGTAGTCCTACCTTAACTCGAGTTAAGGTAGGACTACTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1209s21c1
Sequence:CCGGACTACAGGGAGACCCAATGTCCTCGAGGACATTGGGTCTCCCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366524    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1715s21c1
Sequence:CCGGTCTCACCTTGGACTGATATTACTCGAGTAATATCAGTCCAAGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1019s21c1
Sequence:CCGGTGGCACCATTGTCATCCAATACTCGAGTATTGGATGACAATGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030714.2-445s21c1
Sequence:CCGGATCGGGTGTCCATCCTCATAGCTCGAGCTATGAGGATGGACACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-575s21c1
Sequence:CCGGAGAGGCAGAGAAAGAGCTAAACTCGAGTTTAGCTCTTTCTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1339s21c1
Sequence:CCGGAGGGTATCACAGACGACTGAGCTCGAGCTCAGTCGTCTGTGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1305s21c1
Sequence:CCGGTACCTGACTAGGGTGCAAGAGCTCGAGCTCTTGCACCCTAGTCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030714.2-1155s21c1
Sequence:CCGGCTGTTCCGAAAGGCATTTGACCTCGAGGTCAAATGCCTTTCGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030714.2-1703s1c1
Sequence:CCGGCCCTGAATACTGTCTCACCTTCTCGAGAAGGTGAGACAGTATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_030714.2-1226s1c1
Sequence:CCGGTGTCATCACTTGGAACGACATCTCGAGATGTCGTTCCAAGTGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_030714.2-566s1c1
Sequence:CCGGGCTACTGAAAGAGGCAGAGAACTCGAGTTCTCTGCCTCTTTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030714.2-457s1c1
Sequence:CCGGTCCTCATAGATGGCGAGACTTCTCGAGAAGTCTCGCCATCTATGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030714.2-1007s1c1
Sequence:CCGGCTACGAGAAGTATGGCACCATCTCGAGATGGTGCCATACTTCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178502
VALIDATED
DTX3 MISSION shRNA Bacterial Glycerol Stock
deltex homolog 3 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178502.2-1030s21c1
Sequence:CCGGCTATGAGAAGTACGGCACCATCTCGAGATGGTGCCGTACTTCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178502.2-1844s21c1
Sequence:CCGGGCTGTGTGTGTTCATCAGATACTCGAGTATCTGATGAACACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178502.2-490s21c1
Sequence:CCGGTGGCGAGACTTCTGACATCTACTCGAGTAGATGTCAGAAGTCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178502.2-602s21c1
Sequence:CCGGGCAGAGAAAGAGCTGAAGAAACTCGAGTTTCTTCAGCTCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178502.2-1199s21c1
Sequence:CCGGCAGCGTCTCACCTTCACTATCCTCGAGGATAGTGAAGGTGAGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178502.2-1844s1c1
Sequence:CCGGGCTGTGTGTGTTCATCAGATACTCGAGTATCTGATGAACACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178502.2-1030s1c1
Sequence:CCGGCTATGAGAAGTACGGCACCATCTCGAGATGGTGCCGTACTTCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178502.2-602s1c1
Sequence:CCGGGCAGAGAAAGAGCTGAAGAAACTCGAGTTTCTTCAGCTCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178502.2-469s1c1
Sequence:CCGGCCGTGTGTCTATCCTCATAGACTCGAGTCTATGAGGATAGACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178502.2-490s1c1
Sequence:CCGGTGGCGAGACTTCTGACATCTACTCGAGTAGATGTCAGAAGTCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178502
VALIDATED
DTX3 MISSION shRNA shRNA Plasmid DNA
deltex homolog 3 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178502.2-1030s21c1
Sequence:CCGGCTATGAGAAGTACGGCACCATCTCGAGATGGTGCCGTACTTCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178502.2-1844s21c1
Sequence:CCGGGCTGTGTGTGTTCATCAGATACTCGAGTATCTGATGAACACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178502.2-490s21c1
Sequence:CCGGTGGCGAGACTTCTGACATCTACTCGAGTAGATGTCAGAAGTCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178502.2-602s21c1
Sequence:CCGGGCAGAGAAAGAGCTGAAGAAACTCGAGTTTCTTCAGCTCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178502.2-1199s21c1
Sequence:CCGGCAGCGTCTCACCTTCACTATCCTCGAGGATAGTGAAGGTGAGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178502.2-1844s1c1
Sequence:CCGGGCTGTGTGTGTTCATCAGATACTCGAGTATCTGATGAACACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178502.2-1030s1c1
Sequence:CCGGCTATGAGAAGTACGGCACCATCTCGAGATGGTGCCGTACTTCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178502.2-602s1c1
Sequence:CCGGGCAGAGAAAGAGCTGAAGAAACTCGAGTTTCTTCAGCTCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178502.2-469s1c1
Sequence:CCGGCCGTGTGTCTATCCTCATAGACTCGAGTCTATGAGGATAGACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178502.2-490s1c1
Sequence:CCGGTGGCGAGACTTCTGACATCTACTCGAGTAGATGTCAGAAGTCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178502
VALIDATED
DTX3 MISSION shRNA Lentiviral Transduction Particles
deltex homolog 3 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178502.2-1030s21c1
Sequence:CCGGCTATGAGAAGTACGGCACCATCTCGAGATGGTGCCGTACTTCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178502.2-1844s21c1
Sequence:CCGGGCTGTGTGTGTTCATCAGATACTCGAGTATCTGATGAACACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178502.2-490s21c1
Sequence:CCGGTGGCGAGACTTCTGACATCTACTCGAGTAGATGTCAGAAGTCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178502.2-602s21c1
Sequence:CCGGGCAGAGAAAGAGCTGAAGAAACTCGAGTTTCTTCAGCTCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178502.2-1199s21c1
Sequence:CCGGCAGCGTCTCACCTTCACTATCCTCGAGGATAGTGAAGGTGAGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178502.2-1844s1c1
Sequence:CCGGGCTGTGTGTGTTCATCAGATACTCGAGTATCTGATGAACACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178502.2-1030s1c1
Sequence:CCGGCTATGAGAAGTACGGCACCATCTCGAGATGGTGCCGTACTTCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178502.2-602s1c1
Sequence:CCGGGCAGAGAAAGAGCTGAAGAAACTCGAGTTTCTTCAGCTCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178502.2-469s1c1
Sequence:CCGGCCGTGTGTCTATCCTCATAGACTCGAGTCTATGAGGATAGACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178502.2-490s1c1
Sequence:CCGGTGGCGAGACTTCTGACATCTACTCGAGTAGATGTCAGAAGTCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks