EMAIL THIS PAGE TO A FRIEND

DTX3L

deltex 3-like (Drosophila)

63 Gene Product Result for
Synonyms: BBAP
UniProtKB ID: Q8TDB6, B3KWH6, Q53ZZ3, Q5MJP7
Gene ID:
Human(151636) Summary: DTX3L functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]
Mouse(209200) deltex 3-like (Drosophila)
Rat(498089) deltex 3-like (Drosophila)
chicken(424267) deltex 3-like (Drosophila)
cow(515051) deltex 3-like (Drosophila)
domestic cat(101087089) deltex 3-like (Drosophila)
dog(478586) deltex 3-like (Drosophila)
sheep(101119106) deltex 3-like (Drosophila)
Domestic Rabbit(100340510) deltex 3-like (Drosophila)
naked mole-rat(101697379) deltex 3-like (Drosophila)
domestic guinea pig(100717246) deltex 3-like (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138287 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138287 Rosetta Predictions human pricing
NM_001109053 Rosetta Predictions rat pricing
NM_001013371 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027837 predicted 988
2 SASI_Hs01_00027838 predicted 971
3 SASI_Hs01_00027839 predicted 1187
4 SASI_Hs01_00027840 predicted 834
5 SASI_Hs01_00027841 predicted 1142
6 SASI_Hs01_00027842 predicted 1698
7 SASI_Hs01_00027843 predicted 2169
8 SASI_Hs02_00363372 predicted 1087
9 SASI_Hs02_00363373 predicted 1785
10 SASI_Hs01_00027845 predicted 2085
11 SASI_Hs01_00027836 predicted 1907
12 SASI_Hs01_00027844 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244660 predicted 862
2 SASI_Rn02_00244661 predicted 2216
3 SASI_Rn02_00244662 predicted 1015
4 SASI_Rn02_00244663 predicted 729
5 SASI_Rn02_00244664 predicted 942
6 SASI_Rn02_00244665 predicted 753
7 SASI_Rn02_00244666 predicted 1536
8 SASI_Rn02_00244667 predicted 2225
9 SASI_Rn02_00244668 predicted 2016
10 SASI_Rn02_00244669 predicted 1485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287179 predicted 2206
2 SASI_Mm02_00287180 predicted 930
3 SASI_Mm02_00287181 predicted 364
4 SASI_Mm02_00287182 predicted 2408
5 SASI_Mm02_00287183 predicted 1073
6 SASI_Mm02_00287184 predicted 854
7 SASI_Mm02_00287185 predicted 2015
8 SASI_Mm02_00287186 predicted 2034
9 SASI_Mm02_00287187 predicted 640
10 SASI_Mm02_00287188 predicted 2063
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138287
VALIDATED
DTX3L MISSION shRNA Bacterial Glycerol Stock
deltex 3-like (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138287.2-2287s1c1
Sequence:CCGGGCTGATTTAATGCCAGTCTAACTCGAGTTAGACTGGCATTAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_138287.2-1587s1c1
Sequence:CCGGCCGATGGACATTGATAGCGATCTCGAGATCGCTATCAATGTCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_138287.2-1398s1c1
Sequence:CCGGCACTTACATCAGACCAAGTTTCTCGAGAAACTTGGTCTGATGTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138287.2-2085s1c1
Sequence:CCGGCGCGTATTAGGAGTCTCAGATCTCGAGATCTGAGACTCCTAATACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138287.2-1119s1c1
Sequence:CCGGGCCAATTACATGATGAATGTACTCGAGTACATTCATCATGTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138287.2-1012s21c1
Sequence:CCGGAGGAGAAAGGAGGCGAATTAACTCGAGTTAATTCGCCTCCTTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138287.2-1592s21c1
Sequence:CCGGGGACATTGATAGCGATGATTCCTCGAGGAATCATCGCTATCAATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138287.2-2789s21c1
Sequence:CCGGTTAGAGGTGGGTCCGAAATAACTCGAGTTATTTCGGACCCACCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138287.2-1990s21c1
Sequence:GTACCGGCTGCATACTTGCCTGATAATACTCGAGTATTATCAGGCAAGTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138287.2-1899s21c1
Sequence:CCGGGGCACCATTGTGATTACTTATCTCGAGATAAGTAATCACAATGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138287
VALIDATED
DTX3L MISSION shRNA shRNA Plasmid DNA
deltex 3-like (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138287.2-2287s1c1
Sequence:CCGGGCTGATTTAATGCCAGTCTAACTCGAGTTAGACTGGCATTAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_138287.2-1587s1c1
Sequence:CCGGCCGATGGACATTGATAGCGATCTCGAGATCGCTATCAATGTCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_138287.2-1398s1c1
Sequence:CCGGCACTTACATCAGACCAAGTTTCTCGAGAAACTTGGTCTGATGTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138287.2-2085s1c1
Sequence:CCGGCGCGTATTAGGAGTCTCAGATCTCGAGATCTGAGACTCCTAATACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138287.2-1119s1c1
Sequence:CCGGGCCAATTACATGATGAATGTACTCGAGTACATTCATCATGTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138287.2-1012s21c1
Sequence:CCGGAGGAGAAAGGAGGCGAATTAACTCGAGTTAATTCGCCTCCTTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138287.2-1592s21c1
Sequence:CCGGGGACATTGATAGCGATGATTCCTCGAGGAATCATCGCTATCAATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138287.2-2789s21c1
Sequence:CCGGTTAGAGGTGGGTCCGAAATAACTCGAGTTATTTCGGACCCACCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138287.2-1990s21c1
Sequence:GTACCGGCTGCATACTTGCCTGATAATACTCGAGTATTATCAGGCAAGTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138287.2-1899s21c1
Sequence:CCGGGGCACCATTGTGATTACTTATCTCGAGATAAGTAATCACAATGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138287
VALIDATED
DTX3L MISSION shRNA Lentiviral Transduction Particles
deltex 3-like (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138287.2-2287s1c1
Sequence:CCGGGCTGATTTAATGCCAGTCTAACTCGAGTTAGACTGGCATTAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_138287.2-1587s1c1
Sequence:CCGGCCGATGGACATTGATAGCGATCTCGAGATCGCTATCAATGTCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_138287.2-1398s1c1
Sequence:CCGGCACTTACATCAGACCAAGTTTCTCGAGAAACTTGGTCTGATGTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138287.2-2085s1c1
Sequence:CCGGCGCGTATTAGGAGTCTCAGATCTCGAGATCTGAGACTCCTAATACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138287.2-1119s1c1
Sequence:CCGGGCCAATTACATGATGAATGTACTCGAGTACATTCATCATGTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138287.2-1012s21c1
Sequence:CCGGAGGAGAAAGGAGGCGAATTAACTCGAGTTAATTCGCCTCCTTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138287.2-1592s21c1
Sequence:CCGGGGACATTGATAGCGATGATTCCTCGAGGAATCATCGCTATCAATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138287.2-2789s21c1
Sequence:CCGGTTAGAGGTGGGTCCGAAATAACTCGAGTTATTTCGGACCCACCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138287.2-1990s21c1
Sequence:GTACCGGCTGCATACTTGCCTGATAATACTCGAGTATTATCAGGCAAGTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138287.2-1899s21c1
Sequence:CCGGGGCACCATTGTGATTACTTATCTCGAGATAAGTAATCACAATGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013371
DTX3L MISSION shRNA Bacterial Glycerol Stock
deltex 3-like (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013371.1-3428s1c1
Sequence:CCGGCCCTTGTATAAATGGGAACTTCTCGAGAAGTTCCCATTTATACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013371.1-821s1c1
Sequence:CCGGCCGGGTAGACTAGAGTTCATACTCGAGTATGAACTCTAGTCTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013371.1-422s1c1
Sequence:CCGGGCACTTTGTGATGACATACATCTCGAGATGTATGTCATCACAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013371.1-2057s1c1
Sequence:CCGGCGAACTGCATACTTGCCTGATCTCGAGATCAGGCAAGTATGCAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013371.1-871s1c1
Sequence:CCGGCCAAGCTAGTTCTCCCAATATCTCGAGATATTGGGAGAACTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013371
DTX3L MISSION shRNA shRNA Plasmid DNA
deltex 3-like (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013371.1-3428s1c1
Sequence:CCGGCCCTTGTATAAATGGGAACTTCTCGAGAAGTTCCCATTTATACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013371.1-821s1c1
Sequence:CCGGCCGGGTAGACTAGAGTTCATACTCGAGTATGAACTCTAGTCTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013371.1-422s1c1
Sequence:CCGGGCACTTTGTGATGACATACATCTCGAGATGTATGTCATCACAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013371.1-2057s1c1
Sequence:CCGGCGAACTGCATACTTGCCTGATCTCGAGATCAGGCAAGTATGCAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013371.1-871s1c1
Sequence:CCGGCCAAGCTAGTTCTCCCAATATCTCGAGATATTGGGAGAACTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013371
DTX3L MISSION shRNA Lentiviral Transduction Particles
deltex 3-like (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013371.1-3428s1c1
Sequence:CCGGCCCTTGTATAAATGGGAACTTCTCGAGAAGTTCCCATTTATACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013371.1-821s1c1
Sequence:CCGGCCGGGTAGACTAGAGTTCATACTCGAGTATGAACTCTAGTCTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013371.1-422s1c1
Sequence:CCGGGCACTTTGTGATGACATACATCTCGAGATGTATGTCATCACAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013371.1-2057s1c1
Sequence:CCGGCGAACTGCATACTTGCCTGATCTCGAGATCAGGCAAGTATGCAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013371.1-871s1c1
Sequence:CCGGCCAAGCTAGTTCTCCCAATATCTCGAGATATTGGGAGAACTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks