EMAIL THIS PAGE TO A FRIEND

DTX4

deltex homolog 4 (Drosophila)

Synonyms: RNF155
UniProtKB ID: Q9Y2E6, Q0VF38
Gene ID:
Mouse(207521) deltex 4 homolog (Drosophila)
Rat(293774) deltex homolog 4 (Drosophila)
domestic guinea pig(100723700) deltex homolog 4 (Drosophila)
naked mole-rat(101709153) deltex homolog 4 (Drosophila)
sheep(101110361) deltex homolog 4 (Drosophila)
Domestic Rabbit(100346085) deltex homolog 4 (Drosophila)
chicken(395516) deltex homolog 4 (Drosophila)
dog(483461) deltex homolog 4 (Drosophila)
domestic cat(101095436) deltex homolog 4 (Drosophila)
cow(528508) deltex homolog 4 (Drosophila)
Horse(100066645) deltex homolog 4 (Drosophila)
254 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015177 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172442 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172442 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172442 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015177 Rosetta Predictions human pricing
XM_166213 Rosetta Predictions human pricing
NM_001047855 Rosetta Predictions rat pricing
NM_172442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347202 predicted 1253
2 SASI_Hs02_00347203 predicted 1997
3 SASI_Hs02_00347204 predicted 635
4 SASI_Hs02_00347205 predicted 1995
5 SASI_Hs02_00347206 predicted 1630
6 SASI_Hs02_00347207 predicted 910
7 SASI_Hs02_00347208 predicted 1305
8 SASI_Hs02_00347209 predicted 2034
9 SASI_Hs02_00347210 predicted 1966
10 SASI_Hs02_00347211 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_166213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284691 predicted 1451
2 SASI_Hs01_00284692 predicted 2195
3 SASI_Hs01_00284693 predicted 825
4 SASI_Hs01_00284694 predicted 840
5 SASI_Hs01_00284695 predicted 2191
6 SASI_Hs01_00284696 predicted 1830
7 SASI_Hs01_00284697 predicted 1501
8 SASI_Hs01_00284698 predicted 2233
9 SASI_Hs01_00284699 predicted 2163
10 SASI_Hs01_00284700 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206225 predicted 414
2 SASI_Rn02_00206226 predicted 469
3 SASI_Rn02_00206227 predicted 593
4 SASI_Rn02_00206228 predicted 427
5 SASI_Rn02_00206229 predicted 494
6 SASI_Rn02_00206230 predicted 464
7 SASI_Rn02_00206231 predicted 319
8 SASI_Rn02_00206232 predicted 492
9 SASI_Rn02_00206233 predicted 598
10 SASI_Rn02_00206234 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062649 predicted 2509
2 SASI_Mm01_00062650 predicted 2662
3 SASI_Mm01_00062651 predicted 2358
4 SASI_Mm01_00062652 predicted 2481
5 SASI_Mm01_00062653 predicted 2486
6 SASI_Mm01_00062654 predicted 2694
7 SASI_Mm01_00062655 predicted 2160
8 SASI_Mm01_00062657 predicted 1633
9 SASI_Mm01_00062658 predicted 1820
10 SASI_Mm02_00343941 predicted 1538
11 SASI_Mm01_00062656 predicted 1601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015177
VALIDATED
DTX4 MISSION shRNA Bacterial Glycerol Stock
deltex homolog 4 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015177.1-3397s21c1
Sequence:CCGGCTCATCTCCCTCATCTATTATCTCGAGATAATAGATGAGGGAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015177.1-856s21c1
Sequence:CCGGTTAAGGCAGCCGTGGTCAATGCTCGAGCATTGACCACGGCTGCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015177.1-641s21c1
Sequence:CCGGCATTGGCTTTAGCTACGTAATCTCGAGATTACGTAGCTAAAGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015177.1-2025s21c1
Sequence:CCGGGGCTACCCAGATGCCAATTACCTCGAGGTAATTGGCATCTGGGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015177.1-1335s21c1
Sequence:CCGGCCCGTCAGCAAGAGTGAAATACTCGAGTATTTCACTCTTGCTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015177
VALIDATED
DTX4 MISSION shRNA shRNA Plasmid DNA
deltex homolog 4 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015177.1-3397s21c1
Sequence:CCGGCTCATCTCCCTCATCTATTATCTCGAGATAATAGATGAGGGAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015177.1-856s21c1
Sequence:CCGGTTAAGGCAGCCGTGGTCAATGCTCGAGCATTGACCACGGCTGCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015177.1-641s21c1
Sequence:CCGGCATTGGCTTTAGCTACGTAATCTCGAGATTACGTAGCTAAAGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015177.1-2025s21c1
Sequence:CCGGGGCTACCCAGATGCCAATTACCTCGAGGTAATTGGCATCTGGGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015177.1-1335s21c1
Sequence:CCGGCCCGTCAGCAAGAGTGAAATACTCGAGTATTTCACTCTTGCTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015177
VALIDATED
DTX4 MISSION shRNA Lentiviral Transduction Particles
deltex homolog 4 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015177.1-3397s21c1
Sequence:CCGGCTCATCTCCCTCATCTATTATCTCGAGATAATAGATGAGGGAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015177.1-856s21c1
Sequence:CCGGTTAAGGCAGCCGTGGTCAATGCTCGAGCATTGACCACGGCTGCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015177.1-641s21c1
Sequence:CCGGCATTGGCTTTAGCTACGTAATCTCGAGATTACGTAGCTAAAGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015177.1-2025s21c1
Sequence:CCGGGGCTACCCAGATGCCAATTACCTCGAGGTAATTGGCATCTGGGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015177.1-1335s21c1
Sequence:CCGGCCCGTCAGCAAGAGTGAAATACTCGAGTATTTCACTCTTGCTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172442
VALIDATED
DTX4 MISSION shRNA Bacterial Glycerol Stock
deltex homolog 4 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172442.2-1096s1c1
Sequence:CCGGGCCACTTTGAATCGGTCCAATCTCGAGATTGGACCGATTCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172442.2-1619s1c1
Sequence:CCGGGCCCAACATGTAAGACCATTTCTCGAGAAATGGTCTTACATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172442.2-2002s1c1
Sequence:CCGGCCAGATGCCAATTACCTGGATCTCGAGATCCAGGTAATTGGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172442.2-1885s1c1
Sequence:CCGGCGCCGTCTCATCTTTGCCATTCTCGAGAATGGCAAAGATGAGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172442.2-621s1c1
Sequence:CCGGCATTGGCTTCAGCTACATAATCTCGAGATTATGTAGCTGAAGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172442
VALIDATED
DTX4 MISSION shRNA shRNA Plasmid DNA
deltex homolog 4 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172442.2-1096s1c1
Sequence:CCGGGCCACTTTGAATCGGTCCAATCTCGAGATTGGACCGATTCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172442.2-1619s1c1
Sequence:CCGGGCCCAACATGTAAGACCATTTCTCGAGAAATGGTCTTACATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172442.2-2002s1c1
Sequence:CCGGCCAGATGCCAATTACCTGGATCTCGAGATCCAGGTAATTGGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172442.2-1885s1c1
Sequence:CCGGCGCCGTCTCATCTTTGCCATTCTCGAGAATGGCAAAGATGAGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172442.2-621s1c1
Sequence:CCGGCATTGGCTTCAGCTACATAATCTCGAGATTATGTAGCTGAAGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172442
VALIDATED
DTX4 MISSION shRNA Lentiviral Transduction Particles
deltex homolog 4 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172442.2-1096s1c1
Sequence:CCGGGCCACTTTGAATCGGTCCAATCTCGAGATTGGACCGATTCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172442.2-1619s1c1
Sequence:CCGGGCCCAACATGTAAGACCATTTCTCGAGAAATGGTCTTACATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172442.2-2002s1c1
Sequence:CCGGCCAGATGCCAATTACCTGGATCTCGAGATCCAGGTAATTGGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172442.2-1885s1c1
Sequence:CCGGCGCCGTCTCATCTTTGCCATTCTCGAGAATGGCAAAGATGAGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172442.2-621s1c1
Sequence:CCGGCATTGGCTTCAGCTACATAATCTCGAGATTATGTAGCTGAAGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks