EMAIL THIS PAGE TO A FRIEND

DTYMK

deoxythymidylate kinase (thymidylate kinase)

87 Gene Product Result for
Synonyms: CDC8 PP3731 TMPK TYMK
UniProtKB ID: P23919, Q6FGX1, Q9BUX4
Gene ID:
Mouse(21915) deoxythymidylate kinase
Rat(301622) deoxythymidylate kinase (thymidylate kinase)
Zebrafish(567734) deoxythymidylate kinase (thymidylate kinase)
chicken(770258) deoxythymidylate kinase (thymidylate kinase)
cow(506946) deoxythymidylate kinase (thymidylate kinase)
sheep(101121994) deoxythymidylate kinase (thymidylate kinase)
naked mole-rat(101720182) deoxythymidylate kinase (thymidylate kinase)
domestic guinea pig(100722278) deoxythymidylate kinase (thymidylate kinase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T1895 Thymidine powder, BioReagent, suitable for cell culture human pricing
T9250 Thymidine ≥99% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012145 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110291 MISSION® esiRNA esiRNA human DTYMK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012145 Rosetta Predictions human pricing
NM_001106925 Rosetta Predictions rat pricing
NM_001105667 Rosetta Predictions mouse pricing
NM_023136 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224758 predicted 459
2 SASI_Hs02_00343709 predicted 506
3 SASI_Hs02_00343710 predicted 507
4 SASI_Hs01_00224760 predicted 382
5 SASI_Hs01_00224763 predicted 461
6 SASI_Hs02_00343711 predicted 504
7 SASI_Hs01_00224764 predicted 529
8 SASI_Hs01_00224766 predicted 457
9 SASI_Hs01_00224767 predicted 517
10 SASI_Hs02_00343712 predicted 762
11 SASI_Hs01_00224759 predicted 255
12 SASI_Hs01_00224761 predicted 260
13 SASI_Hs01_00224762 predicted 261
14 SASI_Hs01_00224765 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223756 predicted 346
2 SASI_Rn02_00223757 predicted 349
3 SASI_Rn02_00223758 predicted 449
4 SASI_Rn02_00223759 predicted 458
5 SASI_Rn02_00223760 predicted 798
6 SASI_Rn02_00223761 predicted 686
7 SASI_Rn02_00223762 predicted 581
8 SASI_Rn02_00223763 predicted 661
9 SASI_Rn02_00223764 predicted 846
10 SASI_Rn02_00223765 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304014 predicted 334
2 SASI_Mm02_00304015 predicted 485
3 SASI_Mm02_00304016 predicted 533
4 SASI_Mm02_00304017 predicted 687
5 SASI_Mm02_00304018 predicted 347
6 SASI_Mm02_00304019 predicted 652
7 SASI_Mm02_00304020 predicted 331
8 SASI_Mm02_00304021 predicted 648
9 SASI_Mm02_00304022 predicted 483
10 SASI_Mm02_00304023 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326846 predicted 307
2 SASI_Mm01_00194649 predicted 330
3 SASI_Mm02_00326847 predicted 400
4 SASI_Mm02_00326848 predicted 237
5 SASI_Mm02_00326849 predicted 303
6 SASI_Mm02_00326850 predicted 254
7 SASI_Mm02_00326851 predicted 244
8 SASI_Mm02_00326852 predicted 329
9 SASI_Mm01_00194658 predicted 325
10 SASI_Mm02_00326853 predicted 295
11 SASI_Mm01_00194650 predicted 233
12 SASI_Mm01_00194651 predicted 356
13 SASI_Mm01_00194652 predicted 344
14 SASI_Mm01_00194653 predicted 235
15 SASI_Mm01_00194654 predicted 352
16 SASI_Mm01_00194655 predicted 356
17 SASI_Mm01_00194656 predicted 351
18 SASI_Mm01_00194657 predicted 237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012145
VALIDATED
DTYMK MISSION shRNA Bacterial Glycerol Stock
deoxythymidylate kinase (thymidylate kinase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-760s1c1
Sequence:CCGGCCACAACTTCAGGAGCTCTTTCTCGAGAAAGAGCTCCTGAAGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-176s1c1
Sequence:CCGGCGGCAAACTTCTGAGTTCCTACTCGAGTAGGAACTCAGAAGTTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-527s1c1
Sequence:CCGGGCTCATGAAAGACACGACTTTCTCGAGAAAGTCGTGTCTTTCATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-155s1c1
Sequence:CCGGCCCGGAAAGATCAACTGAAATCTCGAGATTTCAGTTGATCTTTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-258s1c1
Sequence:CCGGTGGGAACAAGTGCCGTTAATTCTCGAGAATTAACGGCACTTGTTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-417s1c1
Sequence:CCGGGTCCTGTTCCTCCAGTTACAGCTCGAGCTGTAACTGGAGGAACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-463s1c1
Sequence:CCGGCGTTTGGCCATGAGCGCTATGCTCGAGCATAGCGCTCATGGCCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-785s1c1
Sequence:CCGGGCAGCAGAGATCTGCAGGCTGCTCGAGCAGCCTGCAGATCTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-309s1c1
Sequence:CCGGGTCGTGGACAGATACGCATTTCTCGAGAAATGCGTATCTGTCCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-367s1c1
Sequence:CCGGCCCTAGATTGGTGTAAACAGCCTCGAGGCTGTTTACACCAATCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012145
VALIDATED
DTYMK MISSION shRNA shRNA Plasmid DNA
deoxythymidylate kinase (thymidylate kinase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-760s1c1
Sequence:CCGGCCACAACTTCAGGAGCTCTTTCTCGAGAAAGAGCTCCTGAAGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-176s1c1
Sequence:CCGGCGGCAAACTTCTGAGTTCCTACTCGAGTAGGAACTCAGAAGTTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-527s1c1
Sequence:CCGGGCTCATGAAAGACACGACTTTCTCGAGAAAGTCGTGTCTTTCATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-155s1c1
Sequence:CCGGCCCGGAAAGATCAACTGAAATCTCGAGATTTCAGTTGATCTTTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-258s1c1
Sequence:CCGGTGGGAACAAGTGCCGTTAATTCTCGAGAATTAACGGCACTTGTTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-417s1c1
Sequence:CCGGGTCCTGTTCCTCCAGTTACAGCTCGAGCTGTAACTGGAGGAACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-463s1c1
Sequence:CCGGCGTTTGGCCATGAGCGCTATGCTCGAGCATAGCGCTCATGGCCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-785s1c1
Sequence:CCGGGCAGCAGAGATCTGCAGGCTGCTCGAGCAGCCTGCAGATCTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-309s1c1
Sequence:CCGGGTCGTGGACAGATACGCATTTCTCGAGAAATGCGTATCTGTCCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-367s1c1
Sequence:CCGGCCCTAGATTGGTGTAAACAGCCTCGAGGCTGTTTACACCAATCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012145
VALIDATED
DTYMK MISSION shRNA Lentiviral Transduction Particles
deoxythymidylate kinase (thymidylate kinase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-760s1c1
Sequence:CCGGCCACAACTTCAGGAGCTCTTTCTCGAGAAAGAGCTCCTGAAGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-176s1c1
Sequence:CCGGCGGCAAACTTCTGAGTTCCTACTCGAGTAGGAACTCAGAAGTTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-527s1c1
Sequence:CCGGGCTCATGAAAGACACGACTTTCTCGAGAAAGTCGTGTCTTTCATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-155s1c1
Sequence:CCGGCCCGGAAAGATCAACTGAAATCTCGAGATTTCAGTTGATCTTTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-258s1c1
Sequence:CCGGTGGGAACAAGTGCCGTTAATTCTCGAGAATTAACGGCACTTGTTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-417s1c1
Sequence:CCGGGTCCTGTTCCTCCAGTTACAGCTCGAGCTGTAACTGGAGGAACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-463s1c1
Sequence:CCGGCGTTTGGCCATGAGCGCTATGCTCGAGCATAGCGCTCATGGCCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-785s1c1
Sequence:CCGGGCAGCAGAGATCTGCAGGCTGCTCGAGCAGCCTGCAGATCTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-309s1c1
Sequence:CCGGGTCGTGGACAGATACGCATTTCTCGAGAAATGCGTATCTGTCCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012145.2-367s1c1
Sequence:CCGGCCCTAGATTGGTGTAAACAGCCTCGAGGCTGTTTACACCAATCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023136
VALIDATED
DTYMK MISSION shRNA Bacterial Glycerol Stock
deoxythymidylate kinase (thymidylate kinase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023136.1-198s1c1
Sequence:CCGGCAAGCTTCTGAATTCCTACTTCTCGAGAAGTAGGAATTCAGAAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023136.1-190s1c1
Sequence:CCGGGAAATCGGCAAGCTTCTGAATCTCGAGATTCAGAAGCTTGCCGATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023136.1-229s1c1
Sequence:CCGGACGGAACTAGAGGATCACTCTCTCGAGAGAGTGATCCTCTAGTTCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023136.1-102s1c1
Sequence:CCGGCAAGACCACGCAGGGCCTCAACTCGAGTTGAGGCCCTGCGTGGTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023136.1-261s1c1
Sequence:CCGGCTTCTCTGCAAACCGCTGGGACTCGAGTCCCAGCGGTTTGCAGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023136.2-304s21c1
Sequence:CCGGACTCCGTGCACCTGCTCTTCTCTCGAGAGAAGAGCAGGTGCACGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023136.2-410s21c1
Sequence:CCGGGAGCACCTGTGTGTGGCATGTCTCGAGACATGCCACACACAGGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023136.2-420s21c1
Sequence:CCGGGTGTGGCATGTGTGCAAACACCTCGAGGTGTTTGCACACATGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023136.2-345s21c1
Sequence:CCGGGTGTAAAGACCTGCGTCGTTGCTCGAGCAACGACGCAGGTCTTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023136.2-331s21c1
Sequence:CCGGACCGCTGGGAACAAGTGTAAACTCGAGTTTACACTTGTTCCCAGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023136
VALIDATED
DTYMK MISSION shRNA shRNA Plasmid DNA
deoxythymidylate kinase (thymidylate kinase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023136.1-198s1c1
Sequence:CCGGCAAGCTTCTGAATTCCTACTTCTCGAGAAGTAGGAATTCAGAAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023136.1-190s1c1
Sequence:CCGGGAAATCGGCAAGCTTCTGAATCTCGAGATTCAGAAGCTTGCCGATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023136.1-229s1c1
Sequence:CCGGACGGAACTAGAGGATCACTCTCTCGAGAGAGTGATCCTCTAGTTCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023136.1-102s1c1
Sequence:CCGGCAAGACCACGCAGGGCCTCAACTCGAGTTGAGGCCCTGCGTGGTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023136.1-261s1c1
Sequence:CCGGCTTCTCTGCAAACCGCTGGGACTCGAGTCCCAGCGGTTTGCAGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023136.2-304s21c1
Sequence:CCGGACTCCGTGCACCTGCTCTTCTCTCGAGAGAAGAGCAGGTGCACGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023136.2-410s21c1
Sequence:CCGGGAGCACCTGTGTGTGGCATGTCTCGAGACATGCCACACACAGGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023136.2-420s21c1
Sequence:CCGGGTGTGGCATGTGTGCAAACACCTCGAGGTGTTTGCACACATGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023136.2-345s21c1
Sequence:CCGGGTGTAAAGACCTGCGTCGTTGCTCGAGCAACGACGCAGGTCTTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023136.2-331s21c1
Sequence:CCGGACCGCTGGGAACAAGTGTAAACTCGAGTTTACACTTGTTCCCAGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023136
VALIDATED
DTYMK MISSION shRNA Lentiviral Transduction Particles
deoxythymidylate kinase (thymidylate kinase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023136.1-198s1c1
Sequence:CCGGCAAGCTTCTGAATTCCTACTTCTCGAGAAGTAGGAATTCAGAAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023136.1-190s1c1
Sequence:CCGGGAAATCGGCAAGCTTCTGAATCTCGAGATTCAGAAGCTTGCCGATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023136.1-229s1c1
Sequence:CCGGACGGAACTAGAGGATCACTCTCTCGAGAGAGTGATCCTCTAGTTCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023136.1-102s1c1
Sequence:CCGGCAAGACCACGCAGGGCCTCAACTCGAGTTGAGGCCCTGCGTGGTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023136.1-261s1c1
Sequence:CCGGCTTCTCTGCAAACCGCTGGGACTCGAGTCCCAGCGGTTTGCAGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023136.2-304s21c1
Sequence:CCGGACTCCGTGCACCTGCTCTTCTCTCGAGAGAAGAGCAGGTGCACGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023136.2-410s21c1
Sequence:CCGGGAGCACCTGTGTGTGGCATGTCTCGAGACATGCCACACACAGGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023136.2-420s21c1
Sequence:CCGGGTGTGGCATGTGTGCAAACACCTCGAGGTGTTTGCACACATGCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023136.2-345s21c1
Sequence:CCGGGTGTAAAGACCTGCGTCGTTGCTCGAGCAACGACGCAGGTCTTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023136.2-331s21c1
Sequence:CCGGACCGCTGGGAACAAGTGTAAACTCGAGTTTACACTTGTTCCCAGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks