EMAIL THIS PAGE TO A FRIEND

DUOX1

dual oxidase 1

Synonyms: LNOX1 NOXEF1 THOX1
UniProtKB ID: Q9NRD9, A6NH28, Q14C94, Q6ZMB3, Q6ZR09, Q9NZC1
Gene ID:
Human(53905) Summary: The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Mouse(99439) dual oxidase 1
Rat(266807) dual oxidase 1
dog(403720) dual oxidase 1
domestic cat(101091374) dual oxidase 1
cow(510409) dual oxidase 1
naked mole-rat(101698133) dual oxidase 1
sheep(101111972) dual oxidase 1
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017434 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099297 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099297 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099297 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU193121 MISSION® esiRNA esiRNA targeting mouse Duox1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017434 Rosetta Predictions human pricing
NM_175940 Rosetta Predictions human pricing
NM_153739 Rosetta Predictions rat pricing
XM_001081004 Rosetta Predictions rat pricing
NM_001099297 Rosetta Predictions mouse pricing
XM_130483 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350011 predicted 652
2 SASI_Hs02_00350012 predicted 2593
3 SASI_Hs01_00014815 predicted 3215
4 SASI_Hs01_00014816 predicted 3635
5 SASI_Hs01_00014817 predicted 4405
6 SASI_Hs01_00014818 predicted 3205
7 SASI_Hs01_00014819 predicted 3737
8 SASI_Hs01_00014820 predicted 5027
9 SASI_Hs01_00014821 predicted 4966
10 SASI_Hs01_00014822 predicted 2401
11 SASI_Hs01_00014814 predicted 4575
12 SASI_Hs01_00014823 predicted 3536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369192 predicted 454
2 SASI_Hs02_00369193 predicted 2394
3 SASI_Hs01_00051419 predicted 3019
4 SASI_Hs01_00051420 predicted 3439
5 SASI_Hs01_00051421 predicted 4214
6 SASI_Hs01_00051422 predicted 3014
7 SASI_Hs01_00051423 predicted 3538
8 SASI_Hs01_00051424 predicted 4831
9 SASI_Hs01_00051425 predicted 4775
10 SASI_Hs01_00051426 predicted 2204
11 SASI_Hs01_00051418 predicted 4386
12 SASI_Hs01_00051427 predicted 3342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051554 predicted 3433
2 SASI_Rn01_00051556 predicted 2885
3 SASI_Rn01_00051557 predicted 1604
4 SASI_Rn01_00051558 predicted 1035
5 SASI_Rn01_00051559 predicted 4253
6 SASI_Rn01_00051560 predicted 4156
7 SASI_Rn01_00051561 predicted 4623
8 SASI_Rn01_00051562 predicted 2921
9 SASI_Rn01_00051563 predicted 877
10 SASI_Rn02_00269037 predicted 2609
11 SASI_Rn01_00051555 predicted 1607
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370204 predicted 3365
2 SASI_Rn02_00370205 predicted 2816
3 SASI_Rn02_00370206 predicted 1538
4 SASI_Rn02_00370207 predicted 964
5 SASI_Rn02_00370208 predicted 4184
6 SASI_Rn02_00370209 predicted 202
7 SASI_Rn02_00370210 predicted 4088
8 SASI_Rn02_00370211 predicted 4556
9 SASI_Rn02_00370212 predicted 2857
10 SASI_Rn02_00370213 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099297 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301571 predicted 1161
2 SASI_Mm02_00301572 predicted 2011
3 SASI_Mm02_00301573 predicted 3972
4 SASI_Mm02_00301574 predicted 4743
5 SASI_Mm02_00301575 predicted 3717
6 SASI_Mm02_00301576 predicted 1796
7 SASI_Mm02_00301577 predicted 1600
8 SASI_Mm02_00301578 predicted 1035
9 SASI_Mm02_00301579 predicted 3216
10 SASI_Mm02_00301580 predicted 2018
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130483 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233030 predicted 2909
2 SASI_Mm01_00233031 predicted 373
3 SASI_Mm01_00233032 predicted 4232
4 SASI_Mm01_00233033 predicted 5000
5 SASI_Mm01_00233034 predicted 251
6 SASI_Mm01_00233035 predicted 3983
7 SASI_Mm01_00233036 predicted 4518
8 SASI_Mm01_00233037 predicted 3472
9 SASI_Mm01_00233038 predicted 240
10 SASI_Mm01_00233039 predicted 4825
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017434
DUOX1 MISSION shRNA Bacterial Glycerol Stock
dual oxidase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017434.3-1456s21c1
Sequence:CCGGTGAGCACCCAAGCCTACAAAGCTCGAGCTTTGTAGGCTTGGGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017434.3-4777s21c1
Sequence:CCGGGGTTCTGAACCGGAGTCTATTCTCGAGAATAGACTCCGGTTCAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017434.3-1841s21c1
Sequence:CCGGACCATCGTCCTTGAACAATTTCTCGAGAAATTGTTCAAGGACGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017434.3-2087s1c1
Sequence:CCGGCCCTCTGTTGTTCGTGACTATCTCGAGATAGTCACGAACAACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017434.3-3883s1c1
Sequence:CCGGCCAGAAGTATTACTGGTGGTTCTCGAGAACCACCAGTAATACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017434.3-2953s1c1
Sequence:CCGGCCTCATTTCCAAGGATGAGTTCTCGAGAACTCATCCTTGGAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017434.3-436s1c1
Sequence:CCGGGCGATTTGATGGGTGGTACAACTCGAGTTGTACCACCCATCAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017434.3-4576s1c1
Sequence:CCGGCCAAGTGTTCTGTAAGAAGATCTCGAGATCTTCTTACAGAACACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017434
DUOX1 MISSION shRNA shRNA Plasmid DNA
dual oxidase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017434.3-1456s21c1
Sequence:CCGGTGAGCACCCAAGCCTACAAAGCTCGAGCTTTGTAGGCTTGGGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017434.3-4777s21c1
Sequence:CCGGGGTTCTGAACCGGAGTCTATTCTCGAGAATAGACTCCGGTTCAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017434.3-1841s21c1
Sequence:CCGGACCATCGTCCTTGAACAATTTCTCGAGAAATTGTTCAAGGACGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017434.3-2087s1c1
Sequence:CCGGCCCTCTGTTGTTCGTGACTATCTCGAGATAGTCACGAACAACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017434.3-3883s1c1
Sequence:CCGGCCAGAAGTATTACTGGTGGTTCTCGAGAACCACCAGTAATACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017434.3-2953s1c1
Sequence:CCGGCCTCATTTCCAAGGATGAGTTCTCGAGAACTCATCCTTGGAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017434.3-436s1c1
Sequence:CCGGGCGATTTGATGGGTGGTACAACTCGAGTTGTACCACCCATCAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017434.3-4576s1c1
Sequence:CCGGCCAAGTGTTCTGTAAGAAGATCTCGAGATCTTCTTACAGAACACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017434
DUOX1 MISSION shRNA Lentiviral Transduction Particles
dual oxidase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017434.3-1456s21c1
Sequence:CCGGTGAGCACCCAAGCCTACAAAGCTCGAGCTTTGTAGGCTTGGGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017434.3-4777s21c1
Sequence:CCGGGGTTCTGAACCGGAGTCTATTCTCGAGAATAGACTCCGGTTCAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017434.3-1841s21c1
Sequence:CCGGACCATCGTCCTTGAACAATTTCTCGAGAAATTGTTCAAGGACGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017434.3-2087s1c1
Sequence:CCGGCCCTCTGTTGTTCGTGACTATCTCGAGATAGTCACGAACAACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017434.3-3883s1c1
Sequence:CCGGCCAGAAGTATTACTGGTGGTTCTCGAGAACCACCAGTAATACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017434.3-2953s1c1
Sequence:CCGGCCTCATTTCCAAGGATGAGTTCTCGAGAACTCATCCTTGGAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017434.3-436s1c1
Sequence:CCGGGCGATTTGATGGGTGGTACAACTCGAGTTGTACCACCCATCAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017434.3-4576s1c1
Sequence:CCGGCCAAGTGTTCTGTAAGAAGATCTCGAGATCTTCTTACAGAACACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099297
DUOX1 MISSION shRNA Bacterial Glycerol Stock
dual oxidase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099297.1-3789s21c1
Sequence:CCGGTCCTGGTCCCTGCAATTATTTCTCGAGAAATAATTGCAGGGACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099297.1-4566s21c1
Sequence:CCGGTCCGAAAGATTGGAGTATTTACTCGAGTAAATACTCCAATCTTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099297.1-121s21c1
Sequence:CCGGGCGATTTGATGGATGGTATAACTCGAGTTATACCATCCATCAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099297.1-2625s21c1
Sequence:CCGGTTGATGGGAACGGTCTCATTTCTCGAGAAATGAGACCGTTCCCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099297.1-4750s21c1
Sequence:CCGGGCCTTAACCCAGTACTCATTTCTCGAGAAATGAGTACTGGGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099297
DUOX1 MISSION shRNA shRNA Plasmid DNA
dual oxidase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099297.1-3789s21c1
Sequence:CCGGTCCTGGTCCCTGCAATTATTTCTCGAGAAATAATTGCAGGGACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099297.1-4566s21c1
Sequence:CCGGTCCGAAAGATTGGAGTATTTACTCGAGTAAATACTCCAATCTTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099297.1-121s21c1
Sequence:CCGGGCGATTTGATGGATGGTATAACTCGAGTTATACCATCCATCAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099297.1-2625s21c1
Sequence:CCGGTTGATGGGAACGGTCTCATTTCTCGAGAAATGAGACCGTTCCCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099297.1-4750s21c1
Sequence:CCGGGCCTTAACCCAGTACTCATTTCTCGAGAAATGAGTACTGGGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099297
DUOX1 MISSION shRNA Lentiviral Transduction Particles
dual oxidase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099297.1-3789s21c1
Sequence:CCGGTCCTGGTCCCTGCAATTATTTCTCGAGAAATAATTGCAGGGACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099297.1-4566s21c1
Sequence:CCGGTCCGAAAGATTGGAGTATTTACTCGAGTAAATACTCCAATCTTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099297.1-121s21c1
Sequence:CCGGGCGATTTGATGGATGGTATAACTCGAGTTATACCATCCATCAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099297.1-2625s21c1
Sequence:CCGGTTGATGGGAACGGTCTCATTTCTCGAGAAATGAGACCGTTCCCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099297.1-4750s21c1
Sequence:CCGGGCCTTAACCCAGTACTCATTTCTCGAGAAATGAGTACTGGGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks