EMAIL THIS PAGE TO A FRIEND

DUOX2

dual oxidase 2

77 Gene Product Result for
Synonyms: LNOX2 NOXEF2 P138-TOX TDH6 THOX2
UniProtKB ID: Q9NRD8, A8MQ13, Q9NR02, Q9UHF9
Gene ID:
Human(50506) Summary: The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes this encoded protein and DUOX1. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. [provided by RefSeq, Jul 2008]
Mouse(214593) dual oxidase 2
Rat(79107) dual oxidase 2
sheep(100462743) dual oxidase 2
naked mole-rat(101698889) dual oxidase 2
chicken(427482) dual oxidase 2
dog(403719) dual oxidase 2
domestic cat(101087408) dual oxidase 2
cow(785698) dual oxidase 2
Horse(100070566) dual oxidase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301720 ANTI-DUOX2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014080 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014080 Rosetta Predictions human pricing
NM_024141 Rosetta Predictions rat pricing
NM_177610 Rosetta Predictions mouse pricing
XM_619809 Rosetta Predictions mouse pricing
XM_901284 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209246 predicted 2788
2 SASI_Hs01_00209247 predicted 1481
3 SASI_Hs01_00209248 predicted 4419
4 SASI_Hs01_00209249 predicted 2771
5 SASI_Hs01_00209250 predicted 3178
6 SASI_Hs01_00209252 predicted 1914
7 SASI_Hs01_00209254 predicted 3331
8 SASI_Hs02_00345109 predicted 1701
9 SASI_Hs01_00209255 predicted 4761
10 SASI_Hs02_00345110 predicted 2095
11 SASI_Hs01_00209251 predicted 3489
12 SASI_Hs01_00209253 predicted 3059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090021 predicted 3124
2 SASI_Rn01_00090022 predicted 3187
3 SASI_Rn01_00090023 predicted 1581
4 SASI_Rn01_00090024 predicted 1740
5 SASI_Rn01_00090025 predicted 865
6 SASI_Rn01_00090026 predicted 2582
7 SASI_Rn01_00090027 predicted 1029
8 SASI_Rn01_00090028 predicted 1825
9 SASI_Rn01_00090029 predicted 3622
10 SASI_Rn01_00090030 predicted 3568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347830 predicted 1253
2 SASI_Mm02_00347831 predicted 3571
3 SASI_Mm02_00347832 predicted 1499
4 SASI_Mm02_00347833 predicted 3131
5 SASI_Mm02_00347834 predicted 1870
6 SASI_Mm02_00347835 predicted 1581
7 SASI_Mm02_00347836 predicted 1855
8 SASI_Mm02_00347837 predicted 3035
9 SASI_Mm02_00347838 predicted 1967
10 SASI_Mm02_00347839 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214991 predicted 1253
2 SASI_Mm01_00214992 predicted 1748
3 SASI_Mm01_00214993 predicted 1507
4 SASI_Mm01_00214994 predicted 1595
5 SASI_Mm01_00214995 predicted 1495
6 SASI_Mm01_00214996 predicted 878
7 SASI_Mm01_00214997 predicted 1025
8 SASI_Mm01_00214998 predicted 202
9 SASI_Mm01_00214999 predicted 1141
10 SASI_Mm01_00215000 predicted 1494
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901284 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250333 predicted 286
2 SASI_Mm01_00250334 predicted 295
3 SASI_Mm01_00250335 predicted 274
4 SASI_Mm01_00250336 predicted 274
5 SASI_Mm01_00250337 predicted 290
6 SASI_Mm01_00250338 predicted 339
7 SASI_Mm01_00250339 predicted 292
8 SASI_Mm01_00250340 predicted 273
9 SASI_Mm01_00250341 predicted 686
10 SASI_Mm01_00250342 predicted 929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014080
DUOX2 MISSION shRNA Bacterial Glycerol Stock
dual oxidase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014080.3-3696s1c1
Sequence:CCGGCCCAACGTCTTTGTGAATGATCTCGAGATCATTCACAAAGACGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014080.3-4818s1c1
Sequence:CCGGGCCCACTTCATGCACCACTATCTCGAGATAGTGGTGCATGAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014080.3-1407s1c1
Sequence:CCGGGAGGACAACATAGTGGTTGAACTCGAGTTCAACCACTATGTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014080.3-3378s1c1
Sequence:CCGGCGTGCTTACTACTATGGCTTTCTCGAGAAAGCCATAGTAGTAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014080.3-2783s1c1
Sequence:CCGGCCGTCTAATGTTTACCATGTACTCGAGTACATGGTAAACATTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014080.4-311s21c1
Sequence:CCGGGCGCTATGACGGCTGGTTTAACTCGAGTTAAACCAGCCGTCATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014080.4-4313s21c1
Sequence:CCGGCCATCAGGAGTGGCATAAATTCTCGAGAATTTATGCCACTCCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014080
DUOX2 MISSION shRNA shRNA Plasmid DNA
dual oxidase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014080.3-3696s1c1
Sequence:CCGGCCCAACGTCTTTGTGAATGATCTCGAGATCATTCACAAAGACGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014080.3-4818s1c1
Sequence:CCGGGCCCACTTCATGCACCACTATCTCGAGATAGTGGTGCATGAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014080.3-1407s1c1
Sequence:CCGGGAGGACAACATAGTGGTTGAACTCGAGTTCAACCACTATGTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014080.3-3378s1c1
Sequence:CCGGCGTGCTTACTACTATGGCTTTCTCGAGAAAGCCATAGTAGTAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014080.3-2783s1c1
Sequence:CCGGCCGTCTAATGTTTACCATGTACTCGAGTACATGGTAAACATTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014080.4-311s21c1
Sequence:CCGGGCGCTATGACGGCTGGTTTAACTCGAGTTAAACCAGCCGTCATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014080.4-4313s21c1
Sequence:CCGGCCATCAGGAGTGGCATAAATTCTCGAGAATTTATGCCACTCCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014080
DUOX2 MISSION shRNA Lentiviral Transduction Particles
dual oxidase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014080.3-3696s1c1
Sequence:CCGGCCCAACGTCTTTGTGAATGATCTCGAGATCATTCACAAAGACGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014080.3-4818s1c1
Sequence:CCGGGCCCACTTCATGCACCACTATCTCGAGATAGTGGTGCATGAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014080.3-1407s1c1
Sequence:CCGGGAGGACAACATAGTGGTTGAACTCGAGTTCAACCACTATGTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014080.3-3378s1c1
Sequence:CCGGCGTGCTTACTACTATGGCTTTCTCGAGAAAGCCATAGTAGTAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014080.3-2783s1c1
Sequence:CCGGCCGTCTAATGTTTACCATGTACTCGAGTACATGGTAAACATTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014080.4-311s21c1
Sequence:CCGGGCGCTATGACGGCTGGTTTAACTCGAGTTAAACCAGCCGTCATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014080.4-4313s21c1
Sequence:CCGGCCATCAGGAGTGGCATAAATTCTCGAGAATTTATGCCACTCCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177610
DUOX2 MISSION shRNA Bacterial Glycerol Stock
dual oxidase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177610.1-969s1c1
Sequence:CCGGCCTCATCCAATTACCCAGCTTCTCGAGAAGCTGGGTAATTGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177610.1-683s1c1
Sequence:CCGGCCACCTCTATGTTGTGCTTTACTCGAGTAAAGCACAACATAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177610.1-241s1c1
Sequence:CCGGCCGTGCCTACTACTATGGCTTCTCGAGAAGCCATAGTAGTAGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177610.1-682s1c1
Sequence:CCGGACCACCTCTATGTTGTGCTTTCTCGAGAAAGCACAACATAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177610.1-242s1c1
Sequence:CCGGCGTGCCTACTACTATGGCTTTCTCGAGAAAGCCATAGTAGTAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177610
DUOX2 MISSION shRNA shRNA Plasmid DNA
dual oxidase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177610.1-969s1c1
Sequence:CCGGCCTCATCCAATTACCCAGCTTCTCGAGAAGCTGGGTAATTGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177610.1-683s1c1
Sequence:CCGGCCACCTCTATGTTGTGCTTTACTCGAGTAAAGCACAACATAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177610.1-241s1c1
Sequence:CCGGCCGTGCCTACTACTATGGCTTCTCGAGAAGCCATAGTAGTAGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177610.1-682s1c1
Sequence:CCGGACCACCTCTATGTTGTGCTTTCTCGAGAAAGCACAACATAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177610.1-242s1c1
Sequence:CCGGCGTGCCTACTACTATGGCTTTCTCGAGAAAGCCATAGTAGTAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177610
DUOX2 MISSION shRNA Lentiviral Transduction Particles
dual oxidase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177610.1-969s1c1
Sequence:CCGGCCTCATCCAATTACCCAGCTTCTCGAGAAGCTGGGTAATTGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177610.1-683s1c1
Sequence:CCGGCCACCTCTATGTTGTGCTTTACTCGAGTAAAGCACAACATAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177610.1-241s1c1
Sequence:CCGGCCGTGCCTACTACTATGGCTTCTCGAGAAGCCATAGTAGTAGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177610.1-682s1c1
Sequence:CCGGACCACCTCTATGTTGTGCTTTCTCGAGAAAGCACAACATAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177610.1-242s1c1
Sequence:CCGGCGTGCCTACTACTATGGCTTTCTCGAGAAAGCCATAGTAGTAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks