EMAIL THIS PAGE TO A FRIEND

DUOXA1

dual oxidase maturation factor 1

48 Gene Product Result for
Synonyms: NIP NUMBIP mol
UniProtKB ID: Q1HG43, Q8N6K9, Q96MI4
Gene ID:
Human(90527) Summary: Dual oxidases DUOX1 and DUOX2 are NADPH oxidases which are involved in hydrogen peroxide production necessary for thyroid hormonogenesis. They form a heterodimer with specific maturation factors DUOXA1 and DUOXA2, respectively, which is essential for the maturation and function of the DUOX enzyme complexes. This gene encodes the DUOX1 activator or maturation factor DUOXA1. Rat studies identified a bidirectional promoter which controls the transcription of the DUOX1 and DUOXA1 genes. This protein is cotransported to the cell surface when coexpressed with DUOX1 and is retained in the endoplasmic reticulum when expressed without DUOX1 protein. The expression of this gene or the DUOX1 gene is not suppressed by thyroglobulin (Tg), a macromolecular precursor in thyroid hormone synthesis, while the expression of the DUOX2 and DUOXA2 are significantly suppressed by the Tg. This protein is also a p53-regulated neurogenic factor involved in p53 dependent neuronal differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
Mouse(213696) dual oxidase maturation factor 1
Rat(311374) dual oxidase maturation factor 1
chicken(427484) dual oxidase maturation factor 1
cow(530151) dual oxidase maturation factor 1
domestic cat(101086977) dual oxidase maturation factor 1
dog(487536) dual oxidase maturation factor 1
domestic guinea pig(100734075) dual oxidase maturation factor 1
naked mole-rat(101698524) dual oxidase maturation factor 1
sheep(101115034) dual oxidase maturation factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144565 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144565 Rosetta Predictions human pricing
NM_001107767 Rosetta Predictions rat pricing
NM_145395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138595 predicted 476
2 SASI_Hs01_00138596 predicted 675
3 SASI_Hs01_00138598 predicted 671
4 SASI_Hs01_00138599 predicted 761
5 SASI_Hs01_00138600 predicted 443
6 SASI_Hs01_00138601 predicted 1109
7 SASI_Hs01_00138602 predicted 562
8 SASI_Hs01_00138603 predicted 462
9 SASI_Hs02_00364334 predicted 1357
10 SASI_Hs02_00364335 predicted 461
11 SASI_Hs01_00138594 predicted 1234
12 SASI_Hs01_00138597 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232065 predicted 1377
2 SASI_Rn02_00232066 predicted 1319
3 SASI_Rn02_00232067 predicted 404
4 SASI_Rn02_00232068 predicted 365
5 SASI_Rn02_00232069 predicted 1349
6 SASI_Rn02_00232070 predicted 724
7 SASI_Rn02_00232071 predicted 1291
8 SASI_Rn02_00232072 predicted 948
9 SASI_Rn02_00232073 predicted 1278
10 SASI_Rn02_00232074 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183145 predicted 1014
2 SASI_Mm01_00183147 predicted 721
3 SASI_Mm02_00340724 predicted 510
4 SASI_Mm01_00183148 predicted 1013
5 SASI_Mm01_00183149 predicted 332
6 SASI_Mm01_00183150 predicted 555
7 SASI_Mm01_00183152 predicted 940
8 SASI_Mm01_00183153 predicted 721
9 SASI_Mm01_00183154 predicted 679
10 SASI_Mm02_00340725 predicted 763
11 SASI_Mm01_00183146 predicted 305
12 SASI_Mm01_00183151 predicted 1118
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145395
DUOXA1 MISSION shRNA Bacterial Glycerol Stock
dual oxidase maturation factor 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145395.2-1020s21c1
Sequence:CCGGCCCGCTTTCTGGATCACGTTACTCGAGTAACGTGATCCAGAAAGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145395.2-1283s21c1
Sequence:CCGGGTCCGACTGTTCCCTGTAAAGCTCGAGCTTTACAGGGAACAGTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145395.1-384s1c1
Sequence:CCGGGCACTGGTCACCTTCATCATTCTCGAGAATGATGAAGGTGACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145395.1-527s1c1
Sequence:CCGGCAACGCCAACACAACGTACAACTCGAGTTGTACGTTGTGTTGGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145395.1-641s1c1
Sequence:CCGGGCTGAATGAAACCATCAACTACTCGAGTAGTTGATGGTTTCATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145395.1-330s1c1
Sequence:CCGGCCAACCTTTCCAATGGACACTCTCGAGAGTGTCCATTGGAAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145395.1-335s1c1
Sequence:CCGGCTTTCCAATGGACACTACTCTCTCGAGAGAGTAGTGTCCATTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145395
DUOXA1 MISSION shRNA shRNA Plasmid DNA
dual oxidase maturation factor 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145395.2-1020s21c1
Sequence:CCGGCCCGCTTTCTGGATCACGTTACTCGAGTAACGTGATCCAGAAAGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145395.2-1283s21c1
Sequence:CCGGGTCCGACTGTTCCCTGTAAAGCTCGAGCTTTACAGGGAACAGTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145395.1-384s1c1
Sequence:CCGGGCACTGGTCACCTTCATCATTCTCGAGAATGATGAAGGTGACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145395.1-527s1c1
Sequence:CCGGCAACGCCAACACAACGTACAACTCGAGTTGTACGTTGTGTTGGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145395.1-641s1c1
Sequence:CCGGGCTGAATGAAACCATCAACTACTCGAGTAGTTGATGGTTTCATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145395.1-330s1c1
Sequence:CCGGCCAACCTTTCCAATGGACACTCTCGAGAGTGTCCATTGGAAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145395.1-335s1c1
Sequence:CCGGCTTTCCAATGGACACTACTCTCTCGAGAGAGTAGTGTCCATTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145395
DUOXA1 MISSION shRNA Lentiviral Transduction Particles
dual oxidase maturation factor 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145395.2-1020s21c1
Sequence:CCGGCCCGCTTTCTGGATCACGTTACTCGAGTAACGTGATCCAGAAAGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145395.2-1283s21c1
Sequence:CCGGGTCCGACTGTTCCCTGTAAAGCTCGAGCTTTACAGGGAACAGTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145395.1-384s1c1
Sequence:CCGGGCACTGGTCACCTTCATCATTCTCGAGAATGATGAAGGTGACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145395.1-527s1c1
Sequence:CCGGCAACGCCAACACAACGTACAACTCGAGTTGTACGTTGTGTTGGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145395.1-641s1c1
Sequence:CCGGGCTGAATGAAACCATCAACTACTCGAGTAGTTGATGGTTTCATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145395.1-330s1c1
Sequence:CCGGCCAACCTTTCCAATGGACACTCTCGAGAGTGTCCATTGGAAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145395.1-335s1c1
Sequence:CCGGCTTTCCAATGGACACTACTCTCTCGAGAGAGTAGTGTCCATTGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144565
DUOXA1 MISSION shRNA Bacterial Glycerol Stock
dual oxidase maturation factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144565.2-666s1c1
Sequence:CCGGCCTTCAGTTCTGAGTGGATCACTCGAGTGATCCACTCAGAACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144565.2-1231s1c1
Sequence:CCGGCAGGCTGAAGGCTTTCTTCAACTCGAGTTGAAGAAAGCCTTCAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144565.2-873s1c1
Sequence:CCGGCTGAGAAGTTCACTCCAAGAACTCGAGTTCTTGGAGTGAACTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144565.2-768s1c1
Sequence:CCGGCCATCAATTACAACGAGGAGTCTCGAGACTCCTCGTTGTAATTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144565.2-806s1c1
Sequence:CCGGGAGAACTATGCTGAGGAGTATCTCGAGATACTCCTCAGCATAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144565.2-1156s1c1
Sequence:CCGGGATCACATTGACCACAGGACTCTCGAGAGTCCTGTGGTCAATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144565.2-1665s1c1
Sequence:CCGGGATCGAAAGAAAGGAGGGCATCTCGAGATGCCCTCCTTTCTTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144565.2-769s1c1
Sequence:CCGGCATCAATTACAACGAGGAGTTCTCGAGAACTCCTCGTTGTAATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144565.2-757s1c1
Sequence:CCGGGCTGAATGAGACCATCAATTACTCGAGTAATTGATGGTCTCATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144565
DUOXA1 MISSION shRNA shRNA Plasmid DNA
dual oxidase maturation factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144565.2-666s1c1
Sequence:CCGGCCTTCAGTTCTGAGTGGATCACTCGAGTGATCCACTCAGAACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144565.2-1231s1c1
Sequence:CCGGCAGGCTGAAGGCTTTCTTCAACTCGAGTTGAAGAAAGCCTTCAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144565.2-873s1c1
Sequence:CCGGCTGAGAAGTTCACTCCAAGAACTCGAGTTCTTGGAGTGAACTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144565.2-768s1c1
Sequence:CCGGCCATCAATTACAACGAGGAGTCTCGAGACTCCTCGTTGTAATTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144565.2-806s1c1
Sequence:CCGGGAGAACTATGCTGAGGAGTATCTCGAGATACTCCTCAGCATAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144565.2-1156s1c1
Sequence:CCGGGATCACATTGACCACAGGACTCTCGAGAGTCCTGTGGTCAATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144565.2-1665s1c1
Sequence:CCGGGATCGAAAGAAAGGAGGGCATCTCGAGATGCCCTCCTTTCTTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144565.2-769s1c1
Sequence:CCGGCATCAATTACAACGAGGAGTTCTCGAGAACTCCTCGTTGTAATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144565.2-757s1c1
Sequence:CCGGGCTGAATGAGACCATCAATTACTCGAGTAATTGATGGTCTCATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144565
DUOXA1 MISSION shRNA Lentiviral Transduction Particles
dual oxidase maturation factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144565.2-666s1c1
Sequence:CCGGCCTTCAGTTCTGAGTGGATCACTCGAGTGATCCACTCAGAACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144565.2-1231s1c1
Sequence:CCGGCAGGCTGAAGGCTTTCTTCAACTCGAGTTGAAGAAAGCCTTCAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144565.2-873s1c1
Sequence:CCGGCTGAGAAGTTCACTCCAAGAACTCGAGTTCTTGGAGTGAACTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144565.2-768s1c1
Sequence:CCGGCCATCAATTACAACGAGGAGTCTCGAGACTCCTCGTTGTAATTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144565.2-806s1c1
Sequence:CCGGGAGAACTATGCTGAGGAGTATCTCGAGATACTCCTCAGCATAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144565.2-1156s1c1
Sequence:CCGGGATCACATTGACCACAGGACTCTCGAGAGTCCTGTGGTCAATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144565.2-1665s1c1
Sequence:CCGGGATCGAAAGAAAGGAGGGCATCTCGAGATGCCCTCCTTTCTTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144565.2-769s1c1
Sequence:CCGGCATCAATTACAACGAGGAGTTCTCGAGAACTCCTCGTTGTAATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144565.2-757s1c1
Sequence:CCGGGCTGAATGAGACCATCAATTACTCGAGTAATTGATGGTCTCATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks