EMAIL THIS PAGE TO A FRIEND

DUOXA2

dual oxidase maturation factor 2

57 Gene Product Result for
Synonyms: SIMNIPHOM TDH5
UniProtKB ID: Q1HG44, B2RPI9, H0YNQ6
Gene ID:
Human(405753) Summary: This gene encodes an endoplasmic reticulum protein that is necessary for proper cellular localization and maturation of functional dual oxidase 2. Mutations in this gene have been associated with thyroid dyshormonogenesis 5.[provided by RefSeq, Feb 2010]
Mouse(66811) dual oxidase maturation factor 2
Rat(499879) dual oxidase maturation factor 2
dog(609210) dual oxidase maturation factor 2
cow(514414) dual oxidase maturation factor 2
domestic cat(101091628) dual oxidase maturation factor 2
sheep(101112229) dual oxidase maturation factor 2
sheep(100379136) dual oxidase maturation factor 2
naked mole-rat(101708812) dual oxidase maturation factor 2
domestic guinea pig(100733797) dual oxidase maturation factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207581 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025777 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025777 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025777 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145471 MISSION® esiRNA esiRNA human DUOXA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207581 Rosetta Predictions human pricing
XM_001080999 Rosetta Predictions rat pricing
XM_575222 Rosetta Predictions rat pricing
NM_025777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196100 predicted 664
2 SASI_Hs01_00196101 predicted 623
3 SASI_Hs01_00196102 predicted 380
4 SASI_Hs01_00196103 predicted 596
5 SASI_Hs01_00196104 predicted 347
6 SASI_Hs01_00196105 predicted 495
7 SASI_Hs01_00196106 predicted 450
8 SASI_Hs01_00196107 predicted 1003
9 SASI_Hs01_00196108 predicted 1185
10 SASI_Hs01_00196109 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370184 predicted 501
2 SASI_Rn02_00370185 predicted 408
3 SASI_Rn02_00370186 predicted 579
4 SASI_Rn02_00370187 predicted 318
5 SASI_Rn02_00370188 predicted 376
6 SASI_Rn02_00370189 predicted 469
7 SASI_Rn02_00370190 predicted 479
8 SASI_Rn02_00370191 predicted 338
9 SASI_Rn02_00370192 predicted 263
10 SASI_Rn02_00370193 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403337 predicted 498
2 SASI_Rn02_00403338 predicted 407
3 SASI_Rn02_00403339 predicted 572
4 SASI_Rn02_00403340 predicted 310
5 SASI_Rn02_00403341 predicted 378
6 SASI_Rn02_00403342 predicted 472
7 SASI_Rn02_00403343 predicted 478
8 SASI_Rn02_00403344 predicted 344
9 SASI_Rn02_00403345 predicted 266
10 SASI_Rn02_00403346 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132590 predicted 976
2 SASI_Mm01_00132591 predicted 634
3 SASI_Mm01_00132592 predicted 519
4 SASI_Mm01_00132593 predicted 316
5 SASI_Mm01_00132594 predicted 334
6 SASI_Mm01_00132595 predicted 529
7 SASI_Mm01_00132596 predicted 864
8 SASI_Mm01_00132597 predicted 633
9 SASI_Mm01_00132598 predicted 1026
10 SASI_Mm01_00132599 predicted 781
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207581
DUOXA2 MISSION shRNA Bacterial Glycerol Stock
dual oxidase maturation factor 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143690    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207581.1-730s1c1
Sequence:CCGGGAGAGTTCTTCTCAGTCTGTTCTCGAGAACAGACTGAGAAGAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207581.1-1364s1c1
Sequence:CCGGGTGGTGAGTCTCCAGTATGTTCTCGAGAACATACTGGAGACTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207581.1-775s1c1
Sequence:CCGGGCACTTCAGTGCAGAATGGTTCTCGAGAACCATTCTGCACTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207581.1-801s1c1
Sequence:CCGGGTACAGTGAACACCAACACATCTCGAGATGTGTTGGTGTTCACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207581.1-922s1c1
Sequence:CCGGGCTGAACGAGACCATTGACTACTCGAGTAGTCAATGGTCTCGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207581.1-354s1c1
Sequence:CCGGCGTGCCTAGCACTTCTGGACTCTCGAGAGTCCAGAAGTGCTAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207581.1-204s1c1
Sequence:CCGGGCTCATCGTTATTCTAGTGTTCTCGAGAACACTAGAATAACGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207581
DUOXA2 MISSION shRNA shRNA Plasmid DNA
dual oxidase maturation factor 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143690    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207581.1-730s1c1
Sequence:CCGGGAGAGTTCTTCTCAGTCTGTTCTCGAGAACAGACTGAGAAGAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207581.1-1364s1c1
Sequence:CCGGGTGGTGAGTCTCCAGTATGTTCTCGAGAACATACTGGAGACTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207581.1-775s1c1
Sequence:CCGGGCACTTCAGTGCAGAATGGTTCTCGAGAACCATTCTGCACTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207581.1-801s1c1
Sequence:CCGGGTACAGTGAACACCAACACATCTCGAGATGTGTTGGTGTTCACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207581.1-922s1c1
Sequence:CCGGGCTGAACGAGACCATTGACTACTCGAGTAGTCAATGGTCTCGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207581.1-354s1c1
Sequence:CCGGCGTGCCTAGCACTTCTGGACTCTCGAGAGTCCAGAAGTGCTAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207581.1-204s1c1
Sequence:CCGGGCTCATCGTTATTCTAGTGTTCTCGAGAACACTAGAATAACGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207581
DUOXA2 MISSION shRNA Lentiviral Transduction Particles
dual oxidase maturation factor 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143690    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207581.1-730s1c1
Sequence:CCGGGAGAGTTCTTCTCAGTCTGTTCTCGAGAACAGACTGAGAAGAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207581.1-1364s1c1
Sequence:CCGGGTGGTGAGTCTCCAGTATGTTCTCGAGAACATACTGGAGACTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207581.1-775s1c1
Sequence:CCGGGCACTTCAGTGCAGAATGGTTCTCGAGAACCATTCTGCACTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207581.1-801s1c1
Sequence:CCGGGTACAGTGAACACCAACACATCTCGAGATGTGTTGGTGTTCACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207581.1-922s1c1
Sequence:CCGGGCTGAACGAGACCATTGACTACTCGAGTAGTCAATGGTCTCGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207581.1-354s1c1
Sequence:CCGGCGTGCCTAGCACTTCTGGACTCTCGAGAGTCCAGAAGTGCTAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207581.1-204s1c1
Sequence:CCGGGCTCATCGTTATTCTAGTGTTCTCGAGAACACTAGAATAACGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025777
DUOXA2 MISSION shRNA Bacterial Glycerol Stock
dual oxidase maturation factor 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025777.1-983s1c1
Sequence:CCGGCTTTCTGGATCTAAGTGTCAACTCGAGTTGACACTTAGATCCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025777.1-1077s1c1
Sequence:CCGGCCAGACTTAAATATTACCACTCTCGAGAGTGGTAATATTTAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025777.1-218s1c1
Sequence:CCGGCATTGTTATCCTGGTGTTCTTCTCGAGAAGAACACCAGGATAACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025777.1-560s1c1
Sequence:CCGGCAAGGAGTATGTCCATGCCTTCTCGAGAAGGCATGGACATACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025777.1-386s1c1
Sequence:CCGGGTGGACCAACACATCCTACAACTCGAGTTGTAGGATGTGTTGGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025777.2-1336s21c1
Sequence:CCGGTTGGCTTCTCTTGGCCATTTGCTCGAGCAAATGGCCAAGAGAAGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025777.2-803s21c1
Sequence:CCGGTCTTCGCCTTCGCCTCGATTTCTCGAGAAATCGAGGCGAAGGCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025777.2-1372s21c1
Sequence:CCGGGAAACTCCTCTAGGCTAGTAACTCGAGTTACTAGCCTAGAGGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025777
DUOXA2 MISSION shRNA shRNA Plasmid DNA
dual oxidase maturation factor 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025777.1-983s1c1
Sequence:CCGGCTTTCTGGATCTAAGTGTCAACTCGAGTTGACACTTAGATCCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025777.1-1077s1c1
Sequence:CCGGCCAGACTTAAATATTACCACTCTCGAGAGTGGTAATATTTAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025777.1-218s1c1
Sequence:CCGGCATTGTTATCCTGGTGTTCTTCTCGAGAAGAACACCAGGATAACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025777.1-560s1c1
Sequence:CCGGCAAGGAGTATGTCCATGCCTTCTCGAGAAGGCATGGACATACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025777.1-386s1c1
Sequence:CCGGGTGGACCAACACATCCTACAACTCGAGTTGTAGGATGTGTTGGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025777.2-1336s21c1
Sequence:CCGGTTGGCTTCTCTTGGCCATTTGCTCGAGCAAATGGCCAAGAGAAGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025777.2-803s21c1
Sequence:CCGGTCTTCGCCTTCGCCTCGATTTCTCGAGAAATCGAGGCGAAGGCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025777.2-1372s21c1
Sequence:CCGGGAAACTCCTCTAGGCTAGTAACTCGAGTTACTAGCCTAGAGGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025777
DUOXA2 MISSION shRNA Lentiviral Transduction Particles
dual oxidase maturation factor 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025777.1-983s1c1
Sequence:CCGGCTTTCTGGATCTAAGTGTCAACTCGAGTTGACACTTAGATCCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025777.1-1077s1c1
Sequence:CCGGCCAGACTTAAATATTACCACTCTCGAGAGTGGTAATATTTAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025777.1-218s1c1
Sequence:CCGGCATTGTTATCCTGGTGTTCTTCTCGAGAAGAACACCAGGATAACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025777.1-560s1c1
Sequence:CCGGCAAGGAGTATGTCCATGCCTTCTCGAGAAGGCATGGACATACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025777.1-386s1c1
Sequence:CCGGGTGGACCAACACATCCTACAACTCGAGTTGTAGGATGTGTTGGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025777.2-1336s21c1
Sequence:CCGGTTGGCTTCTCTTGGCCATTTGCTCGAGCAAATGGCCAAGAGAAGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025777.2-803s21c1
Sequence:CCGGTCTTCGCCTTCGCCTCGATTTCTCGAGAAATCGAGGCGAAGGCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025777.2-1372s21c1
Sequence:CCGGGAAACTCCTCTAGGCTAGTAACTCGAGTTACTAGCCTAGAGGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks