EMAIL THIS PAGE TO A FRIEND

DUPD1

dual specificity phosphatase and pro isomerase domain containing 1

68 Gene Product Result for
Synonyms: DUSP27 FMDSP
UniProtKB ID: Q68J44, B2RP93
Gene ID:
Mouse(435391) dual specificity phosphatase and pro isomerase domain containing 1
Rat(361003) dual specificity phosphatase and pro isomerase domain containing 1
chicken(423733) dual specificity phosphatase and pro isomerase domain containing 1
dog(610073) dual specificity phosphatase and pro isomerase domain containing 1
Horse(100072928) dual specificity phosphatase and pro isomerase domain containing 1
cow(616082) dual specificity phosphatase and pro isomerase domain containing 1
domestic cat(101091049) dual specificity phosphatase and pro isomerase domain containing 1
sheep(101109415) dual specificity phosphatase and pro isomerase domain containing 1
domestic guinea pig(100726672) dual specificity phosphatase and pro isomerase domain containing 1
naked mole-rat(101725646) dual specificity phosphatase and pro isomerase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003892 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_487320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_487320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_487320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003892 Rosetta Predictions human pricing
NM_001108368 Rosetta Predictions rat pricing
XM_341278 Rosetta Predictions rat pricing
NM_001013826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131715 predicted 394
2 SASI_Hs02_00304417 predicted 373
3 SASI_Hs01_00131716 predicted 197
4 SASI_Hs01_00131718 predicted 288
5 SASI_Hs01_00131719 predicted 404
6 SASI_Hs01_00131721 predicted 408
7 SASI_Hs01_00131722 predicted 278
8 SASI_Hs01_00131723 predicted 201
9 SASI_Hs01_00131724 predicted 287
10 SASI_Hs02_00304418 predicted 201
11 SASI_Hs01_00131717 predicted 309
12 SASI_Hs01_00131720 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237979 predicted 400
2 SASI_Rn02_00237980 predicted 446
3 SASI_Rn02_00237981 predicted 579
4 SASI_Rn02_00237982 predicted 600
5 SASI_Rn02_00237983 predicted 390
6 SASI_Rn02_00237984 predicted 561
7 SASI_Rn02_00237985 predicted 516
8 SASI_Rn02_00237986 predicted 403
9 SASI_Rn02_00237987 predicted 737
10 SASI_Rn02_00237988 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166527 predicted 441
2 SASI_Rn01_00166528 predicted 402
3 SASI_Rn01_00166529 predicted 335
4 SASI_Rn01_00166530 predicted 501
5 SASI_Rn01_00166531 predicted 390
6 SASI_Rn01_00166532 predicted 522
7 SASI_Rn01_00166533 predicted 406
8 SASI_Rn01_00166534 predicted 333
9 SASI_Rn01_00166535 predicted 336
10 SASI_Rn01_00166536 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287403 predicted 441
2 SASI_Mm01_00067953 predicted 593
3 SASI_Mm01_00067954 predicted 397
4 SASI_Mm01_00067956 predicted 436
5 SASI_Mm01_00067957 predicted 198
6 SASI_Mm01_00067958 predicted 378
7 SASI_Mm01_00067959 predicted 388
8 SASI_Mm02_00287404 predicted 549
9 SASI_Mm01_00067960 predicted 603
10 SASI_Mm01_00067961 predicted 511
11 SASI_Mm01_00067955 predicted 611
12 SASI_Mm01_00067962 predicted 509
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003892
DUPD1 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase and pro isomerase domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003892.1-477s21c1
Sequence:CCGGGGCCTACCTGATGATCCACAACTCGAGTTGTGGATCATCAGGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003892.1-173s21c1
Sequence:CCGGTCTGGCCCAAGCTCTACATTGCTCGAGCAATGTAGAGCTTGGGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003892.1-26s21c1
Sequence:CCGGGCCTCAAGAATGCCTACTCATCTCGAGATGAGTAGGCATTCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003892.1-406s21c1
Sequence:CCGGCTAAGCGACGACCACAGTAAGCTCGAGCTTACTGTGGTCGTCGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003892.1-415s1c1
Sequence:CCGGGACCACAGTAAGATCCTGGTTCTCGAGAACCAGGATCTTACTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003892.1-303s1c1
Sequence:CCGGCCGCGACATGGACATCCAGTACTCGAGTACTGGATGTCCATGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003892.1-483s1c1
Sequence:CCGGCCTGATGATCCACAAGGACATCTCGAGATGTCCTTGTGGATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003892.1-180s1c1
Sequence:CCGGCAAGCTCTACATTGGCGATGACTCGAGTCATCGCCAATGTAGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003892.1-291s1c1
Sequence:CCGGGCCCGACTACTACCGCGACATCTCGAGATGTCGCGGTAGTAGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003892
DUPD1 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase and pro isomerase domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003892.1-477s21c1
Sequence:CCGGGGCCTACCTGATGATCCACAACTCGAGTTGTGGATCATCAGGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003892.1-173s21c1
Sequence:CCGGTCTGGCCCAAGCTCTACATTGCTCGAGCAATGTAGAGCTTGGGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003892.1-26s21c1
Sequence:CCGGGCCTCAAGAATGCCTACTCATCTCGAGATGAGTAGGCATTCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003892.1-406s21c1
Sequence:CCGGCTAAGCGACGACCACAGTAAGCTCGAGCTTACTGTGGTCGTCGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003892.1-415s1c1
Sequence:CCGGGACCACAGTAAGATCCTGGTTCTCGAGAACCAGGATCTTACTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003892.1-303s1c1
Sequence:CCGGCCGCGACATGGACATCCAGTACTCGAGTACTGGATGTCCATGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003892.1-483s1c1
Sequence:CCGGCCTGATGATCCACAAGGACATCTCGAGATGTCCTTGTGGATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003892.1-180s1c1
Sequence:CCGGCAAGCTCTACATTGGCGATGACTCGAGTCATCGCCAATGTAGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003892.1-291s1c1
Sequence:CCGGGCCCGACTACTACCGCGACATCTCGAGATGTCGCGGTAGTAGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003892
DUPD1 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase and pro isomerase domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003892.1-477s21c1
Sequence:CCGGGGCCTACCTGATGATCCACAACTCGAGTTGTGGATCATCAGGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003892.1-173s21c1
Sequence:CCGGTCTGGCCCAAGCTCTACATTGCTCGAGCAATGTAGAGCTTGGGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003892.1-26s21c1
Sequence:CCGGGCCTCAAGAATGCCTACTCATCTCGAGATGAGTAGGCATTCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003892.1-406s21c1
Sequence:CCGGCTAAGCGACGACCACAGTAAGCTCGAGCTTACTGTGGTCGTCGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003892.1-415s1c1
Sequence:CCGGGACCACAGTAAGATCCTGGTTCTCGAGAACCAGGATCTTACTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003892.1-303s1c1
Sequence:CCGGCCGCGACATGGACATCCAGTACTCGAGTACTGGATGTCCATGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003892.1-483s1c1
Sequence:CCGGCCTGATGATCCACAAGGACATCTCGAGATGTCCTTGTGGATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003892.1-180s1c1
Sequence:CCGGCAAGCTCTACATTGGCGATGACTCGAGTCATCGCCAATGTAGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003892.1-291s1c1
Sequence:CCGGGCCCGACTACTACCGCGACATCTCGAGATGTCGCGGTAGTAGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_487320
DUPD1 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase and pro isomerase domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487320.1-51s1c1
Sequence:CCGGCGACACCATCACAGGATCTTACTCGAGTAAGATCCTGTGATGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487320.1-292s1c1
Sequence:CCGGCGCTTCATCCAGTGTAAGAAACTCGAGTTTCTTACACTGGATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487320.1-759s1c1
Sequence:CCGGCCTGATGATCCACAAGAACATCTCGAGATGTTCTTGTGGATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487320.1-470s1c1
Sequence:CCGGGCAAGTTCCTAAAGGAAAGAACTCGAGTTCTTTCCTTTAGGAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487320.1-462s1c1
Sequence:CCGGCCAAGATAGCAAGTTCCTAAACTCGAGTTTAGGAACTTGCTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_487320
DUPD1 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase and pro isomerase domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487320.1-51s1c1
Sequence:CCGGCGACACCATCACAGGATCTTACTCGAGTAAGATCCTGTGATGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487320.1-292s1c1
Sequence:CCGGCGCTTCATCCAGTGTAAGAAACTCGAGTTTCTTACACTGGATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487320.1-759s1c1
Sequence:CCGGCCTGATGATCCACAAGAACATCTCGAGATGTTCTTGTGGATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487320.1-470s1c1
Sequence:CCGGGCAAGTTCCTAAAGGAAAGAACTCGAGTTCTTTCCTTTAGGAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487320.1-462s1c1
Sequence:CCGGCCAAGATAGCAAGTTCCTAAACTCGAGTTTAGGAACTTGCTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_487320
DUPD1 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase and pro isomerase domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487320.1-51s1c1
Sequence:CCGGCGACACCATCACAGGATCTTACTCGAGTAAGATCCTGTGATGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487320.1-292s1c1
Sequence:CCGGCGCTTCATCCAGTGTAAGAAACTCGAGTTTCTTACACTGGATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487320.1-759s1c1
Sequence:CCGGCCTGATGATCCACAAGAACATCTCGAGATGTTCTTGTGGATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487320.1-470s1c1
Sequence:CCGGGCAAGTTCCTAAAGGAAAGAACTCGAGTTCTTTCCTTTAGGAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_487320.1-462s1c1
Sequence:CCGGCCAAGATAGCAAGTTCCTAAACTCGAGTTTAGGAACTTGCTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks