EMAIL THIS PAGE TO A FRIEND

DUS1L

dihydrouridine synthase 1-like (S. cerevisiae)

39 Gene Product Result for
Synonyms: DUS1 PP3111
UniProtKB ID: Q6P1R4, A6NHV4, Q96AI3
Gene ID:
Mouse(68730) dihydrouridine synthase 1-like (S. cerevisiae)
Zebrafish(322715) dihydrouridine synthase 1-like (S. cerevisiae)
Horse(100057354) dihydrouridine synthase 1-like (S. cerevisiae)
cow(617998) dihydrouridine synthase 1-like (S. cerevisiae)
domestic cat(101081268) dihydrouridine synthase 1-like (S. cerevisiae)
chicken(417381) dihydrouridine synthase 1-like (S. cerevisiae)
dog(475927) dihydrouridine synthase 1-like (S. cerevisiae)
naked mole-rat(101697689) dihydrouridine synthase 1-like (S. cerevisiae)
domestic guinea pig(100714004) dihydrouridine synthase 1-like (S. cerevisiae)
sheep(101111894) dihydrouridine synthase 1-like (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022156 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022156 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022156 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022156 Rosetta Predictions human pricing
NM_026824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052338 predicted 471
2 SASI_Hs01_00052339 predicted 807
3 SASI_Hs01_00052341 predicted 645
4 SASI_Hs01_00052342 predicted 1301
5 SASI_Hs01_00052344 predicted 553
6 SASI_Hs01_00052345 predicted 440
7 SASI_Hs01_00052346 predicted 1402
8 SASI_Hs01_00052347 predicted 1178
9 SASI_Hs02_00355576 predicted 1580
10 SASI_Hs02_00355577 predicted 350
11 SASI_Hs01_00052340 predicted 373
12 SASI_Hs01_00052343 predicted 1511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144194 predicted 647
2 SASI_Mm01_00144195 predicted 1238
3 SASI_Mm01_00144197 predicted 1176
4 SASI_Mm02_00330977 predicted 1416
5 SASI_Mm01_00144198 predicted 307
6 SASI_Mm01_00144199 predicted 837
7 SASI_Mm01_00144200 predicted 1433
8 SASI_Mm01_00144201 predicted 1304
9 SASI_Mm01_00144202 predicted 1214
10 SASI_Mm01_00144203 predicted 1389
11 SASI_Mm01_00144196 predicted 1474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022156
VALIDATED
DUS1L MISSION shRNA Bacterial Glycerol Stock
dihydrouridine synthase 1-like (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_022156.3-811s1c1
Sequence:CCGGCCCTGTGTTTGCTAACGGGAACTCGAGTTCCCGTTAGCAAACACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_022156.3-373s1c1
Sequence:CCGGCGCCAACTACCGGAAGGAGAACTCGAGTTCTCCTTCCGGTAGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022156.3-487s1c1
Sequence:CCGGTCAGGATTACTGTGACGCCATCTCGAGATGGCGTCACAGTAATCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_022156.3-1479s1c1
Sequence:CCGGGCCCAGGTCACGGATTGCTTTCTCGAGAAAGCAATCCGTGACCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022156.3-537s21c1
Sequence:CCGGTAGCCAAGAGAGGTCACTATGCTCGAGCATAGTGACCTCTCTTGGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022156.3-1131s21c1
Sequence:CCGGTGCGGTGTCAGGAGGAGATATCTCGAGATATCTCCTCCTGACACCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022156.3-489s21c1
Sequence:CCGGAGGATTACTGTGACGCCATTGCTCGAGCAATGGCGTCACAGTAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022156.3-1661s21c1
Sequence:CCGGGCCTGGACACGTCCTACTTAACTCGAGTTAAGTAGGACGTGTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022156.3-766s21c1
Sequence:CCGGAGCGTCCTGGGAGCATATCAACTCGAGTTGATATGCTCCCAGGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022156
VALIDATED
DUS1L MISSION shRNA shRNA Plasmid DNA
dihydrouridine synthase 1-like (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_022156.3-811s1c1
Sequence:CCGGCCCTGTGTTTGCTAACGGGAACTCGAGTTCCCGTTAGCAAACACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_022156.3-373s1c1
Sequence:CCGGCGCCAACTACCGGAAGGAGAACTCGAGTTCTCCTTCCGGTAGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022156.3-487s1c1
Sequence:CCGGTCAGGATTACTGTGACGCCATCTCGAGATGGCGTCACAGTAATCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_022156.3-1479s1c1
Sequence:CCGGGCCCAGGTCACGGATTGCTTTCTCGAGAAAGCAATCCGTGACCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022156.3-537s21c1
Sequence:CCGGTAGCCAAGAGAGGTCACTATGCTCGAGCATAGTGACCTCTCTTGGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022156.3-1131s21c1
Sequence:CCGGTGCGGTGTCAGGAGGAGATATCTCGAGATATCTCCTCCTGACACCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022156.3-489s21c1
Sequence:CCGGAGGATTACTGTGACGCCATTGCTCGAGCAATGGCGTCACAGTAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022156.3-1661s21c1
Sequence:CCGGGCCTGGACACGTCCTACTTAACTCGAGTTAAGTAGGACGTGTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022156.3-766s21c1
Sequence:CCGGAGCGTCCTGGGAGCATATCAACTCGAGTTGATATGCTCCCAGGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022156
VALIDATED
DUS1L MISSION shRNA Lentiviral Transduction Particles
dihydrouridine synthase 1-like (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_022156.3-811s1c1
Sequence:CCGGCCCTGTGTTTGCTAACGGGAACTCGAGTTCCCGTTAGCAAACACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_022156.3-373s1c1
Sequence:CCGGCGCCAACTACCGGAAGGAGAACTCGAGTTCTCCTTCCGGTAGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022156.3-487s1c1
Sequence:CCGGTCAGGATTACTGTGACGCCATCTCGAGATGGCGTCACAGTAATCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_022156.3-1479s1c1
Sequence:CCGGGCCCAGGTCACGGATTGCTTTCTCGAGAAAGCAATCCGTGACCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022156.3-537s21c1
Sequence:CCGGTAGCCAAGAGAGGTCACTATGCTCGAGCATAGTGACCTCTCTTGGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022156.3-1131s21c1
Sequence:CCGGTGCGGTGTCAGGAGGAGATATCTCGAGATATCTCCTCCTGACACCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022156.3-489s21c1
Sequence:CCGGAGGATTACTGTGACGCCATTGCTCGAGCAATGGCGTCACAGTAATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022156.3-1661s21c1
Sequence:CCGGGCCTGGACACGTCCTACTTAACTCGAGTTAAGTAGGACGTGTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022156.3-766s21c1
Sequence:CCGGAGCGTCCTGGGAGCATATCAACTCGAGTTGATATGCTCCCAGGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026824
DUS1L MISSION shRNA Bacterial Glycerol Stock
dihydrouridine synthase 1-like (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026824.2-1658s1c1
Sequence:CCGGGTTTCTCTGAAGTCGTGGGTACTCGAGTACCCACGACTTCAGAGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026824.4-1728s21c1
Sequence:CCGGATGAAGCCTGGACACTCTTAACTCGAGTTAAGAGTGTCCAGGCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026824.4-1425s21c1
Sequence:CCGGCCTTCCCTGAAACCCAAATATCTCGAGATATTTGGGTTTCAGGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026824.4-705s21c1
Sequence:CCGGATTCGTGTCTTCCCAGAAATTCTCGAGAATTTCTGGGAAGACACGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026824.4-1425s1c1
Sequence:CCGGCCTTCCCTGAAACCCAAATATCTCGAGATATTTGGGTTTCAGGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026824.4-1462s1c1
Sequence:CCGGGTGGAAATCCAAAGGGCAATACTCGAGTATTGCCCTTTGGATTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026824.4-442s21c1
Sequence:CCGGACCGCAAAGAGAACTTGTATTCTCGAGAATACAAGTTCTCTTTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026824.4-536s21c1
Sequence:CCGGGGCTCTCCTAGCACAAGATTACTCGAGTAATCTTGTGCTAGGAGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026824
DUS1L MISSION shRNA shRNA Plasmid DNA
dihydrouridine synthase 1-like (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026824.2-1658s1c1
Sequence:CCGGGTTTCTCTGAAGTCGTGGGTACTCGAGTACCCACGACTTCAGAGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026824.4-1728s21c1
Sequence:CCGGATGAAGCCTGGACACTCTTAACTCGAGTTAAGAGTGTCCAGGCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026824.4-1425s21c1
Sequence:CCGGCCTTCCCTGAAACCCAAATATCTCGAGATATTTGGGTTTCAGGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026824.4-705s21c1
Sequence:CCGGATTCGTGTCTTCCCAGAAATTCTCGAGAATTTCTGGGAAGACACGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026824.4-1425s1c1
Sequence:CCGGCCTTCCCTGAAACCCAAATATCTCGAGATATTTGGGTTTCAGGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026824.4-1462s1c1
Sequence:CCGGGTGGAAATCCAAAGGGCAATACTCGAGTATTGCCCTTTGGATTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026824.4-442s21c1
Sequence:CCGGACCGCAAAGAGAACTTGTATTCTCGAGAATACAAGTTCTCTTTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026824.4-536s21c1
Sequence:CCGGGGCTCTCCTAGCACAAGATTACTCGAGTAATCTTGTGCTAGGAGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026824
DUS1L MISSION shRNA Lentiviral Transduction Particles
dihydrouridine synthase 1-like (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026824.2-1658s1c1
Sequence:CCGGGTTTCTCTGAAGTCGTGGGTACTCGAGTACCCACGACTTCAGAGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026824.4-1728s21c1
Sequence:CCGGATGAAGCCTGGACACTCTTAACTCGAGTTAAGAGTGTCCAGGCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026824.4-1425s21c1
Sequence:CCGGCCTTCCCTGAAACCCAAATATCTCGAGATATTTGGGTTTCAGGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026824.4-705s21c1
Sequence:CCGGATTCGTGTCTTCCCAGAAATTCTCGAGAATTTCTGGGAAGACACGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026824.4-1425s1c1
Sequence:CCGGCCTTCCCTGAAACCCAAATATCTCGAGATATTTGGGTTTCAGGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026824.4-1462s1c1
Sequence:CCGGGTGGAAATCCAAAGGGCAATACTCGAGTATTGCCCTTTGGATTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026824.4-442s21c1
Sequence:CCGGACCGCAAAGAGAACTTGTATTCTCGAGAATACAAGTTCTCTTTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026824.4-536s21c1
Sequence:CCGGGGCTCTCCTAGCACAAGATTACTCGAGTAATCTTGTGCTAGGAGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)