EMAIL THIS PAGE TO A FRIEND

DUS2

dihydrouridine synthase 2

67 Gene Product Result for
Synonyms: DUS2L SMM1 URLC8
Gene ID:
Human(54920) Summary: This gene encodes a cytoplasmic protein that catalyzes the conversion of uridine residues to dihydrouridine in the D-loop of tRNA. The resulting modified bases confer enhanced regional flexibility to tRNA. The encoded protein may increase the rate of translation by inhibiting an interferon-induced protein kinase. This gene has been implicated in pulmonary carcinogenesis. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
Rat(291978) dihydrouridine synthase 2
Zebrafish(100003049) dihydrouridine synthase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017803 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017803 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017803 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069811 MISSION® esiRNA esiRNA human DUS2L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017803 Rosetta Predictions human pricing
NM_001106181 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156091 predicted 1693
2 SASI_Hs02_00350667 predicted 944
3 SASI_Hs01_00156092 predicted 1370
4 SASI_Hs01_00156093 predicted 475
5 SASI_Hs01_00156094 predicted 1257
6 SASI_Hs01_00156095 predicted 1267
7 SASI_Hs01_00156096 predicted 1183
8 SASI_Hs01_00156097 predicted 982
9 SASI_Hs01_00156098 predicted 1313
10 SASI_Hs01_00156099 predicted 240
11 SASI_Hs01_00156090 predicted 1629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216428 predicted 1177
2 SASI_Rn02_00216429 predicted 1683
3 SASI_Rn02_00216430 predicted 660
4 SASI_Rn02_00216431 predicted 973
5 SASI_Rn02_00216432 predicted 1305
6 SASI_Rn02_00216433 predicted 225
7 SASI_Rn02_00216434 predicted 1202
8 SASI_Rn02_00216435 predicted 396
9 SASI_Rn02_00216436 predicted 1373
10 SASI_Rn02_00216437 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017803
VALIDATED
DUS2 MISSION shRNA Bacterial Glycerol Stock
dihydrouridine synthase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017803.3-1703s21c1
Sequence:CCGGCAGATGCCGTTGAACAGTTTGCTCGAGCAAACTGTTCAACGGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017803.3-1305s21c1
Sequence:CCGGCCTGTGTATGAAACGGTTCAACTCGAGTTGAACCGTTTCATACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_017803.3-977s21c1
Sequence:CCGGCCACTACACCAACACCAAGTACTCGAGTACTTGGTGTTGGTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_017803.3-802s21c1
Sequence:CCGGATGACCACATCCAACAGTATTCTCGAGAATACTGTTGGATGTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_017803.3-566s21c1
Sequence:CCGGGATCCTCAGCACTCTTGTTAACTCGAGTTAACAAGAGTGCTGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017803.3-1305s1c1
Sequence:CCGGCCTGTGTATGAAACGGTTCAACTCGAGTTGAACCGTTTCATACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017803.3-977s1c1
Sequence:CCGGCCACTACACCAACACCAAGTACTCGAGTACTTGGTGTTGGTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017803.3-299s1c1
Sequence:CCGGTCAGTGCAAGAGAGTTGTTAACTCGAGTTAACAACTCTCTTGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_017803.3-1591s1c1
Sequence:CCGGCCTTGGGAAGTGGTGAAGAAACTCGAGTTTCTTCACCACTTCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017803.3-1071s1c1
Sequence:CCGGCGGGAAATTTGTGAGGCCTTTCTCGAGAAAGGCCTCACAAATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017803
VALIDATED
DUS2 MISSION shRNA shRNA Plasmid DNA
dihydrouridine synthase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017803.3-1703s21c1
Sequence:CCGGCAGATGCCGTTGAACAGTTTGCTCGAGCAAACTGTTCAACGGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017803.3-1305s21c1
Sequence:CCGGCCTGTGTATGAAACGGTTCAACTCGAGTTGAACCGTTTCATACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_017803.3-977s21c1
Sequence:CCGGCCACTACACCAACACCAAGTACTCGAGTACTTGGTGTTGGTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_017803.3-802s21c1
Sequence:CCGGATGACCACATCCAACAGTATTCTCGAGAATACTGTTGGATGTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_017803.3-566s21c1
Sequence:CCGGGATCCTCAGCACTCTTGTTAACTCGAGTTAACAAGAGTGCTGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017803.3-1305s1c1
Sequence:CCGGCCTGTGTATGAAACGGTTCAACTCGAGTTGAACCGTTTCATACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017803.3-977s1c1
Sequence:CCGGCCACTACACCAACACCAAGTACTCGAGTACTTGGTGTTGGTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017803.3-299s1c1
Sequence:CCGGTCAGTGCAAGAGAGTTGTTAACTCGAGTTAACAACTCTCTTGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_017803.3-1591s1c1
Sequence:CCGGCCTTGGGAAGTGGTGAAGAAACTCGAGTTTCTTCACCACTTCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017803.3-1071s1c1
Sequence:CCGGCGGGAAATTTGTGAGGCCTTTCTCGAGAAAGGCCTCACAAATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017803
VALIDATED
DUS2 MISSION shRNA Lentiviral Transduction Particles
dihydrouridine synthase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017803.3-1703s21c1
Sequence:CCGGCAGATGCCGTTGAACAGTTTGCTCGAGCAAACTGTTCAACGGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017803.3-1305s21c1
Sequence:CCGGCCTGTGTATGAAACGGTTCAACTCGAGTTGAACCGTTTCATACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_017803.3-977s21c1
Sequence:CCGGCCACTACACCAACACCAAGTACTCGAGTACTTGGTGTTGGTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_017803.3-802s21c1
Sequence:CCGGATGACCACATCCAACAGTATTCTCGAGAATACTGTTGGATGTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_017803.3-566s21c1
Sequence:CCGGGATCCTCAGCACTCTTGTTAACTCGAGTTAACAAGAGTGCTGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017803.3-1305s1c1
Sequence:CCGGCCTGTGTATGAAACGGTTCAACTCGAGTTGAACCGTTTCATACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017803.3-977s1c1
Sequence:CCGGCCACTACACCAACACCAAGTACTCGAGTACTTGGTGTTGGTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017803.3-299s1c1
Sequence:CCGGTCAGTGCAAGAGAGTTGTTAACTCGAGTTAACAACTCTCTTGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_017803.3-1591s1c1
Sequence:CCGGCCTTGGGAAGTGGTGAAGAAACTCGAGTTTCTTCACCACTTCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017803.3-1071s1c1
Sequence:CCGGCGGGAAATTTGTGAGGCCTTTCTCGAGAAAGGCCTCACAAATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks