EMAIL THIS PAGE TO A FRIEND

DUS3L

dihydrouridine synthase 3-like (S. cerevisiae)

48 Gene Product Result for
Synonyms: DUS3
UniProtKB ID: Q96G46, Q96HM5, Q9BSU4, Q9H877, Q9NPR1
Gene ID:
Mouse(224907) dihydrouridine synthase 3-like (S. cerevisiae)
Rat(301122) dihydrouridine synthase 3-like (S. cerevisiae)
sheep(101110760) dihydrouridine synthase 3-like (S. cerevisiae)
naked mole-rat(101709476) dihydrouridine synthase 3-like (S. cerevisiae)
domestic guinea pig(100719819) dihydrouridine synthase 3-like (S. cerevisiae)
Zebrafish(393647) dihydrouridine synthase 3-like (S. cerevisiae)
chicken(428339) dihydrouridine synthase 3-like (S. cerevisiae)
Horse(100147314) dihydrouridine synthase 3-like (S. cerevisiae)
cow(508812) dihydrouridine synthase 3-like (S. cerevisiae)
domestic cat(101084938) dihydrouridine synthase 3-like (S. cerevisiae)
dog(485026) dihydrouridine synthase 3-like (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144858 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144858 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144858 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020175 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020175 Rosetta Predictions human pricing
NM_001034923 Rosetta Predictions rat pricing
NM_144858 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132274 predicted 1300
2 SASI_Hs01_00132275 predicted 1465
3 SASI_Hs01_00132276 predicted 1706
4 SASI_Hs01_00132277 predicted 1115
5 SASI_Hs01_00132278 predicted 1630
6 SASI_Hs01_00132279 predicted 1579
7 SASI_Hs01_00132280 predicted 218
8 SASI_Hs01_00132281 predicted 1267
9 SASI_Hs01_00132282 predicted 1579
10 SASI_Hs01_00132283 predicted 1611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047340 predicted 1383
2 SASI_Rn01_00047341 predicted 963
3 SASI_Rn01_00047342 predicted 355
4 SASI_Rn01_00047343 predicted 1251
5 SASI_Rn01_00047344 predicted 969
6 SASI_Rn01_00047345 predicted 907
7 SASI_Rn01_00047346 predicted 797
8 SASI_Rn01_00047347 predicted 1196
9 SASI_Rn01_00047348 predicted 1746
10 SASI_Rn01_00047349 predicted 1296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106628 predicted 1460
2 SASI_Mm01_00106629 predicted 338
3 SASI_Mm01_00106630 predicted 1760
4 SASI_Mm02_00340282 predicted 321
5 SASI_Mm01_00106631 predicted 1317
6 SASI_Mm01_00106632 predicted 935
7 SASI_Mm01_00106633 predicted 296
8 SASI_Mm01_00106634 predicted 307
9 SASI_Mm01_00106635 predicted 989
10 SASI_Mm01_00106636 predicted 1684
11 SASI_Mm01_00106637 predicted 543
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144858
DUS3L MISSION shRNA Bacterial Glycerol Stock
dihydrouridine synthase 3-like (S. cerevisiae)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144858.2-2126s21c1
Sequence:CCGGAGGCACTCACCGTCCATCATACTCGAGTATGATGGACGGTGAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144858.2-2074s21c1
Sequence:CCGGTTTGAGACAAGATCTCCTGTTCTCGAGAACAGGAGATCTTGTCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144858.2-1720s21c1
Sequence:CCGGGACTTCACTCACTACGGTTTACTCGAGTAAACCGTAGTGAGTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144858.2-342s21c1
Sequence:CCGGGGCAATTGAATCCCGTGAAAGCTCGAGCTTTCACGGGATTCAATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144858.2-1649s21c1
Sequence:CCGGGGCTGTTCACGGAGATCAAAGCTCGAGCTTTGATCTCCGTGAACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144858.2-1865s21c1
Sequence:CCGGAGAGGCCACCCTATTACTTAGCTCGAGCTAAGTAATAGGGTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144858.2-1307s21c1
Sequence:CCGGCCGCCAAGTTCCAACAGATTGCTCGAGCAATCTGTTGGAACTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144858.1-184s1c1
Sequence:CCGGCGGTTCCACGAATATCTGGATCTCGAGATCCAGATATTCGTGGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144858.1-446s1c1
Sequence:CCGGCATGTGCATTTGGAGACCGTTCTCGAGAACGGTCTCCAAATGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144858.1-189s1c1
Sequence:CCGGCCACGAATATCTGGATGGAGACTCGAGTCTCCATCCAGATATTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144858.1-953s1c1
Sequence:CCGGGAAAGCTGTATCTGGCTCCTTCTCGAGAAGGAGCCAGATACAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144858.1-805s1c1
Sequence:CCGGCCAAAGCAGAATAGCTGCCATCTCGAGATGGCAGCTATTCTGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144858
DUS3L MISSION shRNA shRNA Plasmid DNA
dihydrouridine synthase 3-like (S. cerevisiae)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144858.2-2126s21c1
Sequence:CCGGAGGCACTCACCGTCCATCATACTCGAGTATGATGGACGGTGAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144858.2-2074s21c1
Sequence:CCGGTTTGAGACAAGATCTCCTGTTCTCGAGAACAGGAGATCTTGTCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144858.2-1720s21c1
Sequence:CCGGGACTTCACTCACTACGGTTTACTCGAGTAAACCGTAGTGAGTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144858.2-342s21c1
Sequence:CCGGGGCAATTGAATCCCGTGAAAGCTCGAGCTTTCACGGGATTCAATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144858.2-1649s21c1
Sequence:CCGGGGCTGTTCACGGAGATCAAAGCTCGAGCTTTGATCTCCGTGAACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144858.2-1865s21c1
Sequence:CCGGAGAGGCCACCCTATTACTTAGCTCGAGCTAAGTAATAGGGTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144858.2-1307s21c1
Sequence:CCGGCCGCCAAGTTCCAACAGATTGCTCGAGCAATCTGTTGGAACTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144858.1-184s1c1
Sequence:CCGGCGGTTCCACGAATATCTGGATCTCGAGATCCAGATATTCGTGGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144858.1-446s1c1
Sequence:CCGGCATGTGCATTTGGAGACCGTTCTCGAGAACGGTCTCCAAATGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144858.1-189s1c1
Sequence:CCGGCCACGAATATCTGGATGGAGACTCGAGTCTCCATCCAGATATTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144858.1-953s1c1
Sequence:CCGGGAAAGCTGTATCTGGCTCCTTCTCGAGAAGGAGCCAGATACAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144858.1-805s1c1
Sequence:CCGGCCAAAGCAGAATAGCTGCCATCTCGAGATGGCAGCTATTCTGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144858
DUS3L MISSION shRNA Lentiviral Transduction Particles
dihydrouridine synthase 3-like (S. cerevisiae)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144858.2-2126s21c1
Sequence:CCGGAGGCACTCACCGTCCATCATACTCGAGTATGATGGACGGTGAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144858.2-2074s21c1
Sequence:CCGGTTTGAGACAAGATCTCCTGTTCTCGAGAACAGGAGATCTTGTCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144858.2-1720s21c1
Sequence:CCGGGACTTCACTCACTACGGTTTACTCGAGTAAACCGTAGTGAGTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144858.2-342s21c1
Sequence:CCGGGGCAATTGAATCCCGTGAAAGCTCGAGCTTTCACGGGATTCAATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144858.2-1649s21c1
Sequence:CCGGGGCTGTTCACGGAGATCAAAGCTCGAGCTTTGATCTCCGTGAACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144858.2-1865s21c1
Sequence:CCGGAGAGGCCACCCTATTACTTAGCTCGAGCTAAGTAATAGGGTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144858.2-1307s21c1
Sequence:CCGGCCGCCAAGTTCCAACAGATTGCTCGAGCAATCTGTTGGAACTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144858.1-184s1c1
Sequence:CCGGCGGTTCCACGAATATCTGGATCTCGAGATCCAGATATTCGTGGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144858.1-446s1c1
Sequence:CCGGCATGTGCATTTGGAGACCGTTCTCGAGAACGGTCTCCAAATGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144858.1-189s1c1
Sequence:CCGGCCACGAATATCTGGATGGAGACTCGAGTCTCCATCCAGATATTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144858.1-953s1c1
Sequence:CCGGGAAAGCTGTATCTGGCTCCTTCTCGAGAAGGAGCCAGATACAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144858.1-805s1c1
Sequence:CCGGCCAAAGCAGAATAGCTGCCATCTCGAGATGGCAGCTATTCTGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020175
DUS3L MISSION shRNA Bacterial Glycerol Stock
dihydrouridine synthase 3-like (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020175.1-159s21c1
Sequence:CCGGCAAGGAGCAGTTTCACCAATTCTCGAGAATTGGTGAAACTGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020175.1-946s21c1
Sequence:CCGGCGGCTGGACATCCGTGGCAAACTCGAGTTTGCCACGGATGTCCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020175.1-1548s21c1
Sequence:CCGGCTTGTCATTTGAGGATGCCAACTCGAGTTGGCATCCTCAAATGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020175.1-1695s21c1
Sequence:CCGGCCTGCGGGACTTCACCAACTACTCGAGTAGTTGGTGAAGTCCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020175.1-445s21c1
Sequence:CCGGGCTAAGTGTTTCTTCGGTGATCTCGAGATCACCGAAGAAACACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020175.1-445s1c1
Sequence:CCGGGCTAAGTGTTTCTTCGGTGATCTCGAGATCACCGAAGAAACACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020175.1-946s1c1
Sequence:CCGGCGGCTGGACATCCGTGGCAAACTCGAGTTTGCCACGGATGTCCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020175.1-1548s1c1
Sequence:CCGGCTTGTCATTTGAGGATGCCAACTCGAGTTGGCATCCTCAAATGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020175.1-1695s1c1
Sequence:CCGGCCTGCGGGACTTCACCAACTACTCGAGTAGTTGGTGAAGTCCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020175.1-159s1c1
Sequence:CCGGCAAGGAGCAGTTTCACCAATTCTCGAGAATTGGTGAAACTGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020175
DUS3L MISSION shRNA shRNA Plasmid DNA
dihydrouridine synthase 3-like (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020175.1-159s21c1
Sequence:CCGGCAAGGAGCAGTTTCACCAATTCTCGAGAATTGGTGAAACTGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020175.1-946s21c1
Sequence:CCGGCGGCTGGACATCCGTGGCAAACTCGAGTTTGCCACGGATGTCCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020175.1-1548s21c1
Sequence:CCGGCTTGTCATTTGAGGATGCCAACTCGAGTTGGCATCCTCAAATGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020175.1-1695s21c1
Sequence:CCGGCCTGCGGGACTTCACCAACTACTCGAGTAGTTGGTGAAGTCCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020175.1-445s21c1
Sequence:CCGGGCTAAGTGTTTCTTCGGTGATCTCGAGATCACCGAAGAAACACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020175.1-445s1c1
Sequence:CCGGGCTAAGTGTTTCTTCGGTGATCTCGAGATCACCGAAGAAACACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020175.1-946s1c1
Sequence:CCGGCGGCTGGACATCCGTGGCAAACTCGAGTTTGCCACGGATGTCCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020175.1-1548s1c1
Sequence:CCGGCTTGTCATTTGAGGATGCCAACTCGAGTTGGCATCCTCAAATGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020175.1-1695s1c1
Sequence:CCGGCCTGCGGGACTTCACCAACTACTCGAGTAGTTGGTGAAGTCCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020175.1-159s1c1
Sequence:CCGGCAAGGAGCAGTTTCACCAATTCTCGAGAATTGGTGAAACTGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020175
DUS3L MISSION shRNA Lentiviral Transduction Particles
dihydrouridine synthase 3-like (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020175.1-159s21c1
Sequence:CCGGCAAGGAGCAGTTTCACCAATTCTCGAGAATTGGTGAAACTGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020175.1-946s21c1
Sequence:CCGGCGGCTGGACATCCGTGGCAAACTCGAGTTTGCCACGGATGTCCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020175.1-1548s21c1
Sequence:CCGGCTTGTCATTTGAGGATGCCAACTCGAGTTGGCATCCTCAAATGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020175.1-1695s21c1
Sequence:CCGGCCTGCGGGACTTCACCAACTACTCGAGTAGTTGGTGAAGTCCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020175.1-445s21c1
Sequence:CCGGGCTAAGTGTTTCTTCGGTGATCTCGAGATCACCGAAGAAACACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020175.1-445s1c1
Sequence:CCGGGCTAAGTGTTTCTTCGGTGATCTCGAGATCACCGAAGAAACACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020175.1-946s1c1
Sequence:CCGGCGGCTGGACATCCGTGGCAAACTCGAGTTTGCCACGGATGTCCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020175.1-1548s1c1
Sequence:CCGGCTTGTCATTTGAGGATGCCAACTCGAGTTGGCATCCTCAAATGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020175.1-1695s1c1
Sequence:CCGGCCTGCGGGACTTCACCAACTACTCGAGTAGTTGGTGAAGTCCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020175.1-159s1c1
Sequence:CCGGCAAGGAGCAGTTTCACCAATTCTCGAGAATTGGTGAAACTGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks