EMAIL THIS PAGE TO A FRIEND

DUS4L

dihydrouridine synthase 4-like (S. cerevisiae)

Synonyms: DUS4 PP35
UniProtKB ID: O95620, B4DLX0, Q2NKK1
Gene ID:
Mouse(71916) dihydrouridine synthase 4-like (S. cerevisiae)
Rat(366593) dihydrouridine synthase 4-like (S. cerevisiae)
Zebrafish(445096) dihydrouridine synthase 4-like (S. cerevisiae)
cow(511017) dihydrouridine synthase 4-like (S. cerevisiae)
Horse(100050690) dihydrouridine synthase 4-like (S. cerevisiae)
domestic cat(101095327) dihydrouridine synthase 4-like (S. cerevisiae)
chicken(769352) dihydrouridine synthase 4-like (S. cerevisiae)
dog(483264) dihydrouridine synthase 4-like (S. cerevisiae)
domestic guinea pig(100724297) dihydrouridine synthase 4-like (S. cerevisiae)
naked mole-rat(101703428) dihydrouridine synthase 4-like (S. cerevisiae)
sheep(101104143) dihydrouridine synthase 4-like (S. cerevisiae)
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028002 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028002 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028002 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181581 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181581 Rosetta Predictions human pricing
XM_001076117 Rosetta Predictions rat pricing
XM_345654 Rosetta Predictions rat pricing
NM_028002 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239692 predicted 546
2 SASI_Hs01_00239693 predicted 542
3 SASI_Hs01_00239695 predicted 967
4 SASI_Hs01_00239696 predicted 958
5 SASI_Hs01_00239698 predicted 629
6 SASI_Hs01_00239699 predicted 490
7 SASI_Hs01_00239700 predicted 436
8 SASI_Hs01_00239701 predicted 1070
9 SASI_Hs02_00370185 predicted 481
10 SASI_Hs02_00370186 predicted 423
11 SASI_Hs01_00239694 predicted 661
12 SASI_Hs01_00239697 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352085 predicted 844
2 SASI_Rn02_00352086 predicted 224
3 SASI_Rn02_00352087 predicted 229
4 SASI_Rn02_00352088 predicted 483
5 SASI_Rn02_00352089 predicted 577
6 SASI_Rn02_00352090 predicted 549
7 SASI_Rn02_00352091 predicted 1005
8 SASI_Rn02_00352092 predicted 335
9 SASI_Rn02_00352093 predicted 1035
10 SASI_Rn02_00352094 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398593 predicted 610
2 SASI_Rn02_00398594 predicted 223
3 SASI_Rn02_00398595 predicted 230
4 SASI_Rn02_00398596 predicted 491
5 SASI_Rn02_00398597 predicted 579
6 SASI_Rn02_00398598 predicted 303
7 SASI_Rn02_00398599 predicted 476
8 SASI_Rn02_00398600 predicted 335
9 SASI_Rn02_00398601 predicted 655
10 SASI_Rn02_00398602 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028002 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065618 predicted 935
2 SASI_Mm01_00065619 predicted 869
3 SASI_Mm01_00065620 predicted 578
4 SASI_Mm01_00065621 predicted 322
5 SASI_Mm01_00065622 predicted 667
6 SASI_Mm01_00065623 predicted 1158
7 SASI_Mm01_00065624 predicted 908
8 SASI_Mm01_00065625 predicted 429
9 SASI_Mm01_00065626 predicted 539
10 SASI_Mm01_00065627 predicted 811
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028002
DUS4L MISSION shRNA Bacterial Glycerol Stock
dihydrouridine synthase 4-like (S. cerevisiae)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000178561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028002.1-486s1c1
Sequence:CCGGCCCTATGCAAATGGAATAGATCTCGAGATCTATTCCATTTGCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028002.1-1127s1c1
Sequence:CCGGGTCGCTTTCTAAATCTTTGTACTCGAGTACAAAGATTTAGAAAGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028002.1-1290s1c1
Sequence:CCGGCTAAAGGAAGAGGTTTGGAAACTCGAGTTTCCAAACCTCTTCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028002.1-487s1c1
Sequence:CCGGCCTATGCAAATGGAATAGATACTCGAGTATCTATTCCATTTGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028002
DUS4L MISSION shRNA shRNA Plasmid DNA
dihydrouridine synthase 4-like (S. cerevisiae)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000178561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028002.1-486s1c1
Sequence:CCGGCCCTATGCAAATGGAATAGATCTCGAGATCTATTCCATTTGCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028002.1-1127s1c1
Sequence:CCGGGTCGCTTTCTAAATCTTTGTACTCGAGTACAAAGATTTAGAAAGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028002.1-1290s1c1
Sequence:CCGGCTAAAGGAAGAGGTTTGGAAACTCGAGTTTCCAAACCTCTTCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028002.1-487s1c1
Sequence:CCGGCCTATGCAAATGGAATAGATACTCGAGTATCTATTCCATTTGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028002
DUS4L MISSION shRNA Lentiviral Transduction Particles
dihydrouridine synthase 4-like (S. cerevisiae)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000178561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028002.1-486s1c1
Sequence:CCGGCCCTATGCAAATGGAATAGATCTCGAGATCTATTCCATTTGCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028002.1-1127s1c1
Sequence:CCGGGTCGCTTTCTAAATCTTTGTACTCGAGTACAAAGATTTAGAAAGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028002.1-1290s1c1
Sequence:CCGGCTAAAGGAAGAGGTTTGGAAACTCGAGTTTCCAAACCTCTTCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028002.1-487s1c1
Sequence:CCGGCCTATGCAAATGGAATAGATACTCGAGTATCTATTCCATTTGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181581
VALIDATED
DUS4L MISSION shRNA Bacterial Glycerol Stock
dihydrouridine synthase 4-like (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181581.1-631s1c1
Sequence:CCGGGCTCGTATAGTCTGTCCTTATCTCGAGATAAGGACAGACTATACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_181581.1-598s1c1
Sequence:CCGGGCTGCTAACGATGCAAGACTTCTCGAGAAGTCTTGCATCGTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_181581.1-429s1c1
Sequence:CCGGCCCAATGGTTCGATATTCAAACTCGAGTTTGAATATCGAACCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_181581.1-1241s1c1
Sequence:CCGGGCACATCAGCAATCATAGATTCTCGAGAATCTATGATTGCTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_181581.1-502s1c1
Sequence:CCGGCCAATGATTGTTGCCGCTGATCTCGAGATCAGCGGCAACAATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181581.1-1241s21c1
Sequence:CCGGGCACATCAGCAATCATAGATTCTCGAGAATCTATGATTGCTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181581.1-502s21c1
Sequence:CCGGCCAATGATTGTTGCCGCTGATCTCGAGATCAGCGGCAACAATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181581.1-429s21c1
Sequence:CCGGCCCAATGGTTCGATATTCAAACTCGAGTTTGAATATCGAACCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181581.1-631s21c1
Sequence:CCGGGCTCGTATAGTCTGTCCTTATCTCGAGATAAGGACAGACTATACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181581
VALIDATED
DUS4L MISSION shRNA shRNA Plasmid DNA
dihydrouridine synthase 4-like (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181581.1-631s1c1
Sequence:CCGGGCTCGTATAGTCTGTCCTTATCTCGAGATAAGGACAGACTATACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_181581.1-598s1c1
Sequence:CCGGGCTGCTAACGATGCAAGACTTCTCGAGAAGTCTTGCATCGTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_181581.1-429s1c1
Sequence:CCGGCCCAATGGTTCGATATTCAAACTCGAGTTTGAATATCGAACCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_181581.1-1241s1c1
Sequence:CCGGGCACATCAGCAATCATAGATTCTCGAGAATCTATGATTGCTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_181581.1-502s1c1
Sequence:CCGGCCAATGATTGTTGCCGCTGATCTCGAGATCAGCGGCAACAATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181581.1-1241s21c1
Sequence:CCGGGCACATCAGCAATCATAGATTCTCGAGAATCTATGATTGCTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181581.1-502s21c1
Sequence:CCGGCCAATGATTGTTGCCGCTGATCTCGAGATCAGCGGCAACAATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181581.1-429s21c1
Sequence:CCGGCCCAATGGTTCGATATTCAAACTCGAGTTTGAATATCGAACCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181581.1-631s21c1
Sequence:CCGGGCTCGTATAGTCTGTCCTTATCTCGAGATAAGGACAGACTATACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181581
VALIDATED
DUS4L MISSION shRNA Lentiviral Transduction Particles
dihydrouridine synthase 4-like (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181581.1-631s1c1
Sequence:CCGGGCTCGTATAGTCTGTCCTTATCTCGAGATAAGGACAGACTATACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_181581.1-598s1c1
Sequence:CCGGGCTGCTAACGATGCAAGACTTCTCGAGAAGTCTTGCATCGTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_181581.1-429s1c1
Sequence:CCGGCCCAATGGTTCGATATTCAAACTCGAGTTTGAATATCGAACCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_181581.1-1241s1c1
Sequence:CCGGGCACATCAGCAATCATAGATTCTCGAGAATCTATGATTGCTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_181581.1-502s1c1
Sequence:CCGGCCAATGATTGTTGCCGCTGATCTCGAGATCAGCGGCAACAATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181581.1-1241s21c1
Sequence:CCGGGCACATCAGCAATCATAGATTCTCGAGAATCTATGATTGCTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181581.1-502s21c1
Sequence:CCGGCCAATGATTGTTGCCGCTGATCTCGAGATCAGCGGCAACAATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181581.1-429s21c1
Sequence:CCGGCCCAATGGTTCGATATTCAAACTCGAGTTTGAATATCGAACCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181581.1-631s21c1
Sequence:CCGGGCTCGTATAGTCTGTCCTTATCTCGAGATAAGGACAGACTATACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks