EMAIL THIS PAGE TO A FRIEND

DUSP11

dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)

110 Gene Product Result for
Synonyms: PIR1
UniProtKB ID: O75319, B2RCT8, Q6AI47, Q9BWE3
Gene ID:
Human(8446) Summary: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is localized to the nucleus and binds directly to RNA and splicing factors, and thus it is suggested to participate in nuclear mRNA metabolism. [provided by RefSeq, Sep 2008]
Mouse(72102) dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
Rat(297412) dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
sheep(101113742) dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
naked mole-rat(101713434) dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
domestic guinea pig(100713554) dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
Zebrafish(550417) dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
chicken(423818) dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
dog(483110) dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
cow(508944) dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
domestic cat(101098861) dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003584 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028099 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028099 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028099 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003584 siRNAs that have been validated in the lab human pricing
NM_001025650 Rosetta Predictions rat pricing
NM_028099 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003584 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133714 validated 1094
2 SASI_Hs01_00133710 predicted 646
3 SASI_Hs01_00133712 predicted 836
4 SASI_Hs01_00133713 predicted 889
5 SASI_Hs02_00335899 predicted 1085
6 SASI_Hs01_00133715 predicted 610
7 SASI_Hs01_00133716 predicted 402
8 SASI_Hs02_00335900 predicted 929
9 SASI_Hs01_00133717 predicted 1107
10 SASI_Hs01_00133718 predicted 1190
11 SASI_Hs01_00133711 predicted 794
12 SASI_Hs01_00133719 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082237 predicted 743
2 SASI_Rn01_00082238 predicted 542
3 SASI_Rn01_00082239 predicted 503
4 SASI_Rn01_00082241 predicted 549
5 SASI_Rn01_00082242 predicted 673
6 SASI_Rn01_00082243 predicted 501
7 SASI_Rn01_00082244 predicted 825
8 SASI_Rn01_00082245 predicted 615
9 SASI_Rn01_00082246 predicted 745
10 SASI_Rn02_00203223 predicted 541
11 SASI_Rn01_00082240 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140727 predicted 1445
2 SASI_Mm01_00140728 predicted 1293
3 SASI_Mm01_00140730 predicted 1218
4 SASI_Mm01_00140731 predicted 1228
5 SASI_Mm01_00140732 predicted 607
6 SASI_Mm01_00140733 predicted 1071
7 SASI_Mm02_00333343 predicted 1585
8 SASI_Mm01_00140734 predicted 1148
9 SASI_Mm01_00140736 predicted 510
10 SASI_Mm02_00333344 predicted 1059
11 SASI_Mm01_00140729 predicted 1159
12 SASI_Mm01_00140735 predicted 1329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003584
VALIDATED
DUSP11 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003584.2-1431s21c1
Sequence:GTACCGGGAACTTCCCTTGCAAATTATTCTCGAGAATAATTTGCAAGGGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003584.2-567s21c1
Sequence:GTACCGGTAAATTCAAACACGCTGTTAACTCGAGTTAACAGCGTGTTTGAATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003584.2-324s21c1
Sequence:CCGGGACTCGTTTCATTGCTTTCAACTCGAGTTGAAAGCAATGAAACGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003584.2-463s21c1
Sequence:CCGGACATATACTCAACGCTATTATCTCGAGATAATAGCGTTGAGTATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003584.2-663s21c1
Sequence:CCGGCTACCTCATTTGCAGATATTTCTCGAGAAATATCTGCAAATGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003584.2-790s21c1
Sequence:CCGGCCTATCAGAAAGAATTGGAATCTCGAGATTCCAATTCTTTCTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003584.2-1278s21c1
Sequence:CCGGCCCTTATGTATTCAAGCTTAACTCGAGTTAAGCTTGAATACATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003584.x-603s1c1
Sequence:CCGGGCTACCTCATTTGCAGATATTCTCGAGAATATCTGCAAATGAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003584.x-265s1c1
Sequence:CCGGGACTCGTTTCATTGCTTTCAACTCGAGTTGAAAGCAATGAAACGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003584.x-986s1c1
Sequence:CCGGGACTATTCACACAGGAGGTATCTCGAGATACCTCCTGTGTGAATAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003584.x-731s1c1
Sequence:CCGGCCTATCAGAAAGAATTGGAATCTCGAGATTCCAATTCTTTCTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003584.x-1254s1c1
Sequence:CCGGGCTGTTTACCTCTTTGCTGATCTCGAGATCAGCAAAGAGGTAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003584
VALIDATED
DUSP11 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003584.2-1431s21c1
Sequence:GTACCGGGAACTTCCCTTGCAAATTATTCTCGAGAATAATTTGCAAGGGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003584.2-567s21c1
Sequence:GTACCGGTAAATTCAAACACGCTGTTAACTCGAGTTAACAGCGTGTTTGAATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003584.2-324s21c1
Sequence:CCGGGACTCGTTTCATTGCTTTCAACTCGAGTTGAAAGCAATGAAACGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003584.2-463s21c1
Sequence:CCGGACATATACTCAACGCTATTATCTCGAGATAATAGCGTTGAGTATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003584.2-663s21c1
Sequence:CCGGCTACCTCATTTGCAGATATTTCTCGAGAAATATCTGCAAATGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003584.2-790s21c1
Sequence:CCGGCCTATCAGAAAGAATTGGAATCTCGAGATTCCAATTCTTTCTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003584.2-1278s21c1
Sequence:CCGGCCCTTATGTATTCAAGCTTAACTCGAGTTAAGCTTGAATACATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003584.x-603s1c1
Sequence:CCGGGCTACCTCATTTGCAGATATTCTCGAGAATATCTGCAAATGAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003584.x-265s1c1
Sequence:CCGGGACTCGTTTCATTGCTTTCAACTCGAGTTGAAAGCAATGAAACGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003584.x-986s1c1
Sequence:CCGGGACTATTCACACAGGAGGTATCTCGAGATACCTCCTGTGTGAATAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003584.x-731s1c1
Sequence:CCGGCCTATCAGAAAGAATTGGAATCTCGAGATTCCAATTCTTTCTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003584.x-1254s1c1
Sequence:CCGGGCTGTTTACCTCTTTGCTGATCTCGAGATCAGCAAAGAGGTAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003584
VALIDATED
DUSP11 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003584.2-1431s21c1
Sequence:GTACCGGGAACTTCCCTTGCAAATTATTCTCGAGAATAATTTGCAAGGGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003584.2-567s21c1
Sequence:GTACCGGTAAATTCAAACACGCTGTTAACTCGAGTTAACAGCGTGTTTGAATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003584.2-324s21c1
Sequence:CCGGGACTCGTTTCATTGCTTTCAACTCGAGTTGAAAGCAATGAAACGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003584.2-463s21c1
Sequence:CCGGACATATACTCAACGCTATTATCTCGAGATAATAGCGTTGAGTATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003584.2-663s21c1
Sequence:CCGGCTACCTCATTTGCAGATATTTCTCGAGAAATATCTGCAAATGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003584.2-790s21c1
Sequence:CCGGCCTATCAGAAAGAATTGGAATCTCGAGATTCCAATTCTTTCTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003584.2-1278s21c1
Sequence:CCGGCCCTTATGTATTCAAGCTTAACTCGAGTTAAGCTTGAATACATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003584.x-603s1c1
Sequence:CCGGGCTACCTCATTTGCAGATATTCTCGAGAATATCTGCAAATGAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003584.x-265s1c1
Sequence:CCGGGACTCGTTTCATTGCTTTCAACTCGAGTTGAAAGCAATGAAACGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003584.x-986s1c1
Sequence:CCGGGACTATTCACACAGGAGGTATCTCGAGATACCTCCTGTGTGAATAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003584.x-731s1c1
Sequence:CCGGCCTATCAGAAAGAATTGGAATCTCGAGATTCCAATTCTTTCTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003584.x-1254s1c1
Sequence:CCGGGCTGTTTACCTCTTTGCTGATCTCGAGATCAGCAAAGAGGTAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028099
VALIDATED
DUSP11 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028099.2-271s1c1
Sequence:CCGGACTCGTTTCATTGCTTTCAAACTCGAGTTTGAAAGCAATGAAACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028099.2-345s1c1
Sequence:CCGGCCCTTTGGATCTGTTTAATAACTCGAGTTATTAAACAGATCCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028099.2-421s1c1
Sequence:CCGGCGCTATTATAAAGTAGAGGATCTCGAGATCCTCTACTTTATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028099.2-1071s1c1
Sequence:CCGGCCCATACTACTGGGAATGGAACTCGAGTTCCATTCCCAGTAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028099.2-3042s1c1
Sequence:CCGGGCCCTTTGATTTGACTCCTTTCTCGAGAAAGGAGTCAAATCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028099
VALIDATED
DUSP11 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028099.2-271s1c1
Sequence:CCGGACTCGTTTCATTGCTTTCAAACTCGAGTTTGAAAGCAATGAAACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028099.2-345s1c1
Sequence:CCGGCCCTTTGGATCTGTTTAATAACTCGAGTTATTAAACAGATCCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028099.2-421s1c1
Sequence:CCGGCGCTATTATAAAGTAGAGGATCTCGAGATCCTCTACTTTATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028099.2-1071s1c1
Sequence:CCGGCCCATACTACTGGGAATGGAACTCGAGTTCCATTCCCAGTAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028099.2-3042s1c1
Sequence:CCGGGCCCTTTGATTTGACTCCTTTCTCGAGAAAGGAGTCAAATCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028099
VALIDATED
DUSP11 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028099.2-271s1c1
Sequence:CCGGACTCGTTTCATTGCTTTCAAACTCGAGTTTGAAAGCAATGAAACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028099.2-345s1c1
Sequence:CCGGCCCTTTGGATCTGTTTAATAACTCGAGTTATTAAACAGATCCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028099.2-421s1c1
Sequence:CCGGCGCTATTATAAAGTAGAGGATCTCGAGATCCTCTACTTTATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028099.2-1071s1c1
Sequence:CCGGCCCATACTACTGGGAATGGAACTCGAGTTCCATTCCCAGTAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028099.2-3042s1c1
Sequence:CCGGGCCCTTTGATTTGACTCCTTTCTCGAGAAAGGAGTCAAATCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks