EMAIL THIS PAGE TO A FRIEND

DUSP12

dual specificity phosphatase 12

115 Gene Product Result for
Synonyms: DUSP1 YVH1
UniProtKB ID: Q9UNI6, Q5VXA8
Gene ID:
Human(11266) Summary: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is the human ortholog of the Saccharomyces cerevisiae YVH1 protein tyrosine phosphatase. It is localized predominantly in the nucleus, and is novel in that it contains, and is regulated by a zinc finger domain. [provided by RefSeq, Jul 2008]
Mouse(80915) dual specificity phosphatase 12
Rat(64014) dual specificity phosphatase 12
Zebrafish(573998) dual specificity phosphatase 12
cow(505302) dual specificity phosphatase 12
domestic cat(101087296) dual specificity phosphatase 12
dog(478985) dual specificity phosphatase 12
chicken(425349) dual specificity phosphatase 12
domestic guinea pig(100715676) dual specificity phosphatase 12
naked mole-rat(101705133) dual specificity phosphatase 12
sheep(101107242) dual specificity phosphatase 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007240 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007240 siRNAs that have been validated in the lab human pricing
NM_022248 Rosetta Predictions rat pricing
NM_023173 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007240 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035797 validated 599
1 SASI_Hs01_00035798 validated 674
2 SASI_Hs02_00343252 predicted 733
3 SASI_Hs01_00035799 predicted 700
4 SASI_Hs01_00035800 predicted 520
5 SASI_Hs01_00035801 predicted 925
6 SASI_Hs01_00035802 predicted 887
7 SASI_Hs01_00035803 predicted 650
8 SASI_Hs01_00035804 predicted 685
9 SASI_Hs02_00343253 predicted 840
10 SASI_Hs01_00035796 predicted 803
11 SASI_Hs01_00035805 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108055 predicted 791
2 SASI_Rn01_00108056 predicted 548
3 SASI_Rn01_00108057 predicted 681
4 SASI_Rn01_00108058 predicted 896
5 SASI_Rn02_00263030 predicted 734
6 SASI_Rn01_00108059 predicted 606
7 SASI_Rn01_00108060 predicted 832
8 SASI_Rn01_00108061 predicted 622
9 SASI_Rn01_00108062 predicted 536
10 SASI_Rn01_00108063 predicted 764
11 SASI_Rn01_00108064 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060807 predicted 1049
2 SASI_Mm02_00326895 predicted 663
3 SASI_Mm01_00060808 predicted 913
4 SASI_Mm01_00060809 predicted 1011
5 SASI_Mm01_00060811 predicted 560
6 SASI_Mm01_00060812 predicted 838
7 SASI_Mm01_00060813 predicted 1039
8 SASI_Mm02_00326896 predicted 735
9 SASI_Mm02_00326897 predicted 611
10 SASI_Mm02_00326898 predicted 619
11 SASI_Mm01_00060810 predicted 805
12 SASI_Mm01_00060814 predicted 840
13 SASI_Mm01_00060815 predicted 962
14 SASI_Mm01_00060816 predicted 1025
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007240
VALIDATED
DUSP12 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 12
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007240.x-367s1c1
Sequence:CCGGTCAGTCGAAGTGTGGCCATAACTCGAGTTATGGCCACACTTCGACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007240.x-751s1c1
Sequence:CCGGCCCACAAGAGAATGACACCATCTCGAGATGGTGTCATTCTCTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007240.x-524s1c1
Sequence:CCGGAGTGGATACCTCTAGTGCAATCTCGAGATTGCACTAGAGGTATCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007240.x-858s1c1
Sequence:CCGGGTGATGGATGGACAGCTTCTTCTCGAGAAGAAGCTGTCCATCCATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007240.x-1083s1c1
Sequence:CCGGCCTTTGCTTCTTATCATTCATCTCGAGATGAATGATAAGAAGCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007240.1-525s21c1
Sequence:CCGGGTGGATACCTCTAGTGCAATTCTCGAGAATTGCACTAGAGGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007240.1-370s21c1
Sequence:CCGGGTCGAAGTGTGGCCATAATAACTCGAGTTATTATGGCCACACTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007240.1-694s21c1
Sequence:CCGGTATTTCGAAGTTCTAGTATTCCTCGAGGAATACTAGAACTTCGAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007240.1-1081s21c1
Sequence:CCGGTGCCTTTGCTTCTTATCATTCCTCGAGGAATGATAAGAAGCAAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007240.1-723s21c1
Sequence:CCGGCGTGAAGGAAGTGGACCTATACTCGAGTATAGGTCCACTTCCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007240.1-484s21c1
Sequence:CCGGTTGAGTGGCAACTGAAATTATCTCGAGATAATTTCAGTTGCCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007240.1-795s21c1
Sequence:CCGGCAAGCTCAATGTACATCTTATCTCGAGATAAGATGTACATTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007240.1-1056s21c1
Sequence:CCGGGAAGAAACTTGCAGATGATATCTCGAGATATCATCTGCAAGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007240
VALIDATED
DUSP12 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 12
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007240.x-367s1c1
Sequence:CCGGTCAGTCGAAGTGTGGCCATAACTCGAGTTATGGCCACACTTCGACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007240.x-751s1c1
Sequence:CCGGCCCACAAGAGAATGACACCATCTCGAGATGGTGTCATTCTCTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007240.x-524s1c1
Sequence:CCGGAGTGGATACCTCTAGTGCAATCTCGAGATTGCACTAGAGGTATCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007240.x-858s1c1
Sequence:CCGGGTGATGGATGGACAGCTTCTTCTCGAGAAGAAGCTGTCCATCCATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007240.x-1083s1c1
Sequence:CCGGCCTTTGCTTCTTATCATTCATCTCGAGATGAATGATAAGAAGCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007240.1-525s21c1
Sequence:CCGGGTGGATACCTCTAGTGCAATTCTCGAGAATTGCACTAGAGGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007240.1-370s21c1
Sequence:CCGGGTCGAAGTGTGGCCATAATAACTCGAGTTATTATGGCCACACTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007240.1-694s21c1
Sequence:CCGGTATTTCGAAGTTCTAGTATTCCTCGAGGAATACTAGAACTTCGAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007240.1-1081s21c1
Sequence:CCGGTGCCTTTGCTTCTTATCATTCCTCGAGGAATGATAAGAAGCAAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007240.1-723s21c1
Sequence:CCGGCGTGAAGGAAGTGGACCTATACTCGAGTATAGGTCCACTTCCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007240.1-484s21c1
Sequence:CCGGTTGAGTGGCAACTGAAATTATCTCGAGATAATTTCAGTTGCCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007240.1-795s21c1
Sequence:CCGGCAAGCTCAATGTACATCTTATCTCGAGATAAGATGTACATTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007240.1-1056s21c1
Sequence:CCGGGAAGAAACTTGCAGATGATATCTCGAGATATCATCTGCAAGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007240
VALIDATED
DUSP12 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 12
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007240.x-367s1c1
Sequence:CCGGTCAGTCGAAGTGTGGCCATAACTCGAGTTATGGCCACACTTCGACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007240.x-751s1c1
Sequence:CCGGCCCACAAGAGAATGACACCATCTCGAGATGGTGTCATTCTCTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007240.x-524s1c1
Sequence:CCGGAGTGGATACCTCTAGTGCAATCTCGAGATTGCACTAGAGGTATCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007240.x-858s1c1
Sequence:CCGGGTGATGGATGGACAGCTTCTTCTCGAGAAGAAGCTGTCCATCCATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007240.x-1083s1c1
Sequence:CCGGCCTTTGCTTCTTATCATTCATCTCGAGATGAATGATAAGAAGCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007240.1-525s21c1
Sequence:CCGGGTGGATACCTCTAGTGCAATTCTCGAGAATTGCACTAGAGGTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007240.1-370s21c1
Sequence:CCGGGTCGAAGTGTGGCCATAATAACTCGAGTTATTATGGCCACACTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007240.1-694s21c1
Sequence:CCGGTATTTCGAAGTTCTAGTATTCCTCGAGGAATACTAGAACTTCGAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007240.1-1081s21c1
Sequence:CCGGTGCCTTTGCTTCTTATCATTCCTCGAGGAATGATAAGAAGCAAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007240.1-723s21c1
Sequence:CCGGCGTGAAGGAAGTGGACCTATACTCGAGTATAGGTCCACTTCCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007240.1-484s21c1
Sequence:CCGGTTGAGTGGCAACTGAAATTATCTCGAGATAATTTCAGTTGCCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007240.1-795s21c1
Sequence:CCGGCAAGCTCAATGTACATCTTATCTCGAGATAAGATGTACATTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007240.1-1056s21c1
Sequence:CCGGGAAGAAACTTGCAGATGATATCTCGAGATATCATCTGCAAGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023173
VALIDATED
DUSP12 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023173.2-1167s1c1
Sequence:CCGGCTTGGGCTAGATCCTGTGAAACTCGAGTTTCACAGGATCTAGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023173.2-629s1c1
Sequence:CCGGGCAATGGGATACGAAGTCGATCTCGAGATCGACTTCGTATCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023173.2-1010s1c1
Sequence:CCGGAGTGCCAAGTTGGGTTCCTTTCTCGAGAAAGGAACCCAACTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023173.2-710s1c1
Sequence:CCGGCTTTGGAATTTACCTCAGGAACTCGAGTTCCTGAGGTAAATTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023173.2-528s1c1
Sequence:CCGGCCGACCAGCTTACCTTTGAAACTCGAGTTTCAAAGGTAAGCTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023173.2-1167s21c1
Sequence:CCGGCTTGGGCTAGATCCTGTGAAACTCGAGTTTCACAGGATCTAGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023173.2-629s21c1
Sequence:CCGGGCAATGGGATACGAAGTCGATCTCGAGATCGACTTCGTATCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023173.2-710s21c1
Sequence:CCGGCTTTGGAATTTACCTCAGGAACTCGAGTTCCTGAGGTAAATTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023173.2-528s21c1
Sequence:CCGGCCGACCAGCTTACCTTTGAAACTCGAGTTTCAAAGGTAAGCTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023173.2-1010s21c1
Sequence:CCGGAGTGCCAAGTTGGGTTCCTTTCTCGAGAAAGGAACCCAACTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023173
VALIDATED
DUSP12 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023173.2-1167s1c1
Sequence:CCGGCTTGGGCTAGATCCTGTGAAACTCGAGTTTCACAGGATCTAGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023173.2-629s1c1
Sequence:CCGGGCAATGGGATACGAAGTCGATCTCGAGATCGACTTCGTATCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023173.2-1010s1c1
Sequence:CCGGAGTGCCAAGTTGGGTTCCTTTCTCGAGAAAGGAACCCAACTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023173.2-710s1c1
Sequence:CCGGCTTTGGAATTTACCTCAGGAACTCGAGTTCCTGAGGTAAATTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023173.2-528s1c1
Sequence:CCGGCCGACCAGCTTACCTTTGAAACTCGAGTTTCAAAGGTAAGCTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023173.2-1167s21c1
Sequence:CCGGCTTGGGCTAGATCCTGTGAAACTCGAGTTTCACAGGATCTAGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023173.2-629s21c1
Sequence:CCGGGCAATGGGATACGAAGTCGATCTCGAGATCGACTTCGTATCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023173.2-710s21c1
Sequence:CCGGCTTTGGAATTTACCTCAGGAACTCGAGTTCCTGAGGTAAATTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023173.2-528s21c1
Sequence:CCGGCCGACCAGCTTACCTTTGAAACTCGAGTTTCAAAGGTAAGCTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023173.2-1010s21c1
Sequence:CCGGAGTGCCAAGTTGGGTTCCTTTCTCGAGAAAGGAACCCAACTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023173
VALIDATED
DUSP12 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023173.2-1167s1c1
Sequence:CCGGCTTGGGCTAGATCCTGTGAAACTCGAGTTTCACAGGATCTAGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023173.2-629s1c1
Sequence:CCGGGCAATGGGATACGAAGTCGATCTCGAGATCGACTTCGTATCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023173.2-1010s1c1
Sequence:CCGGAGTGCCAAGTTGGGTTCCTTTCTCGAGAAAGGAACCCAACTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023173.2-710s1c1
Sequence:CCGGCTTTGGAATTTACCTCAGGAACTCGAGTTCCTGAGGTAAATTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023173.2-528s1c1
Sequence:CCGGCCGACCAGCTTACCTTTGAAACTCGAGTTTCAAAGGTAAGCTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023173.2-1167s21c1
Sequence:CCGGCTTGGGCTAGATCCTGTGAAACTCGAGTTTCACAGGATCTAGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023173.2-629s21c1
Sequence:CCGGGCAATGGGATACGAAGTCGATCTCGAGATCGACTTCGTATCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023173.2-710s21c1
Sequence:CCGGCTTTGGAATTTACCTCAGGAACTCGAGTTCCTGAGGTAAATTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023173.2-528s21c1
Sequence:CCGGCCGACCAGCTTACCTTTGAAACTCGAGTTTCAAAGGTAAGCTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023173.2-1010s21c1
Sequence:CCGGAGTGCCAAGTTGGGTTCCTTTCTCGAGAAAGGAACCCAACTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks