EMAIL THIS PAGE TO A FRIEND

DUSP13

dual specificity phosphatase 13

141 Gene Product Result for
Synonyms: BEDP DUSP13A DUSP13B MDSP SKRP4 TMDP
Gene ID:
Human(51207) Summary: Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In mouse, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008]
Mouse(27389) dual specificity phosphatase 13
Rat(361002) dual specificity phosphatase 13
chicken(423732) dual specificity phosphatase 13
dog(489054) dual specificity phosphatase 13
cow(616048) dual specificity phosphatase 13
domestic cat(101091309) dual specificity phosphatase 13
sheep(101102034) dual specificity phosphatase 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016364 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013849 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013849 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013849 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007271 Rosetta Predictions human pricing
NM_001007272 Rosetta Predictions human pricing
NM_001007273 Rosetta Predictions human pricing
NM_001007274 Rosetta Predictions human pricing
NM_001007275 Rosetta Predictions human pricing
NM_016364 Rosetta Predictions human pricing
NM_001007006 Rosetta Predictions rat pricing
NM_001007268 Rosetta Predictions mouse pricing
NM_013849 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191666 predicted 875
2 SASI_Hs01_00191667 predicted 167
3 SASI_Hs01_00191668 predicted 1051
4 SASI_Hs01_00191669 predicted 908
5 SASI_Hs01_00191671 predicted 509
6 SASI_Hs01_00191672 predicted 212
7 SASI_Hs01_00191673 predicted 678
8 SASI_Hs01_00191674 predicted 364
9 SASI_Hs01_00191675 predicted 1078
10 SASI_Hs02_00305297 predicted 868
11 SASI_Hs01_00191670 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060414 predicted 546
2 SASI_Hs01_00060415 predicted 786
3 SASI_Hs01_00060416 predicted 713
4 SASI_Hs01_00060417 predicted 481
5 SASI_Hs01_00060418 predicted 437
6 SASI_Hs01_00060420 predicted 406
7 SASI_Hs01_00060421 predicted 711
8 SASI_Hs01_00060422 predicted 465
9 SASI_Hs01_00060423 predicted 412
10 SASI_Hs02_00305298 predicted 418
11 SASI_Hs01_00060419 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205914 predicted 846
2 SASI_Hs01_00205915 predicted 1089
3 SASI_Hs01_00205916 predicted 1015
4 SASI_Hs01_00205917 predicted 776
5 SASI_Hs01_00205918 predicted 737
6 SASI_Hs01_00205920 predicted 705
7 SASI_Hs01_00205921 predicted 1015
8 SASI_Hs01_00205922 predicted 761
9 SASI_Hs01_00205923 predicted 714
10 SASI_Hs02_00305299 predicted 716
11 SASI_Hs01_00205919 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231509 predicted 1007
2 SASI_Hs01_00231510 predicted 966
3 SASI_Hs01_00231511 predicted 933
4 SASI_Hs01_00231512 predicted 992
5 SASI_Hs01_00231513 predicted 930
6 SASI_Hs01_00231514 predicted 671
7 SASI_Hs01_00231515 predicted 169
8 SASI_Hs01_00231516 predicted 704
9 SASI_Hs01_00231517 predicted 224
10 SASI_Hs01_00231518 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169533 predicted 650
2 SASI_Hs01_00169534 predicted 578
3 SASI_Hs01_00169535 predicted 541
4 SASI_Hs01_00169536 predicted 743
5 SASI_Hs01_00169537 predicted 512
6 SASI_Hs01_00169538 predicted 568
7 SASI_Hs01_00169539 predicted 508
8 SASI_Hs01_00169540 predicted 634
9 SASI_Hs01_00169541 predicted 255
10 SASI_Hs01_00169542 predicted 170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026137 predicted 409
2 SASI_Hs01_00026138 predicted 645
3 SASI_Hs01_00026139 predicted 576
4 SASI_Hs01_00026140 predicted 342
5 SASI_Hs01_00026141 predicted 299
6 SASI_Hs01_00026143 predicted 261
7 SASI_Hs01_00026144 predicted 575
8 SASI_Hs01_00026145 predicted 325
9 SASI_Hs01_00026146 predicted 271
10 SASI_Hs02_00349350 predicted 278
11 SASI_Hs01_00026142 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071809 predicted 631
2 SASI_Rn01_00071810 predicted 694
3 SASI_Rn01_00071811 predicted 1011
4 SASI_Rn01_00071812 predicted 840
5 SASI_Rn01_00071813 predicted 936
6 SASI_Rn01_00071814 predicted 763
7 SASI_Rn01_00071815 predicted 618
8 SASI_Rn01_00071816 predicted 592
9 SASI_Rn01_00071817 predicted 723
10 SASI_Rn01_00071818 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183310 predicted 1083
2 SASI_Mm01_00183311 predicted 1087
3 SASI_Mm01_00183312 predicted 164
4 SASI_Mm01_00183313 predicted 912
5 SASI_Mm01_00183314 predicted 673
6 SASI_Mm01_00183315 predicted 716
7 SASI_Mm01_00183317 predicted 27
8 SASI_Mm01_00183318 predicted 841
9 SASI_Mm01_00183319 predicted 412
10 SASI_Mm02_00286728 predicted 1032
11 SASI_Mm01_00183316 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040904 predicted 726
2 SASI_Mm01_00040906 predicted 489
3 SASI_Mm01_00040907 predicted 483
4 SASI_Mm01_00040908 predicted 640
5 SASI_Mm02_00322855 predicted 423
6 SASI_Mm01_00040909 predicted 802
7 SASI_Mm01_00040910 predicted 584
8 SASI_Mm01_00040911 predicted 794
9 SASI_Mm01_00040912 predicted 415
10 SASI_Mm01_00040913 predicted 650
11 SASI_Mm01_00040905 predicted 435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016364
DUSP13 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 13
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016364.3-738s21c1
Sequence:CCGGTCTAGTGACCCTGAGATGTAACTCGAGTTACATCTCAGGGTCACTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-576s21c1
Sequence:CCGGCCGCAATATCTGCCCTAACTCCTCGAGGAGTTAGGGCAGATATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-509s21c1
Sequence:CCGGTCCTGGCCTTCCTCATGATCTCTCGAGAGATCATGAGGAAGGCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-275s21c1
Sequence:CCGGGAATCACCCACGTTGTGAATGCTCGAGCATTCACAACGTGGGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-344s21c1
Sequence:CCGGGAATGTCCCTGGAGTACTATGCTCGAGCATAGTACTCCAGGGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-611s21c1
Sequence:CCGGAGCTCCAGGTTCTGGACAACCCTCGAGGGTTGTCCAGAACCTGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-317s21c1
Sequence:CCGGTGGACACAGGTGCCAAATTCTCTCGAGAGAATTTGGCACCTGTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016364.x-309s1c1
Sequence:CCGGTGCCACACTGAACCATATCGACTCGAGTCGATATGGTTCAGTGTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016364.x-534s1c1
Sequence:CCGGCTTTCTGCCTGTTGCTCGATACTCGAGTATCGAGCAACAGGCAGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016364.x-987s1c1
Sequence:CCGGGTTCAGTCCATCTCTATAATACTCGAGTATTATAGAGATGGACTGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016364.x-657s1c1
Sequence:CCGGTGAGAACATGACGCTGGTAGACTCGAGTCTACCAGCGTCATGTTCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016364.x-529s1c1
Sequence:CCGGGTCTACTTTCTGCCTGTTGCTCTCGAGAGCAACAGGCAGAAAGTAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016364
DUSP13 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 13
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016364.3-738s21c1
Sequence:CCGGTCTAGTGACCCTGAGATGTAACTCGAGTTACATCTCAGGGTCACTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-576s21c1
Sequence:CCGGCCGCAATATCTGCCCTAACTCCTCGAGGAGTTAGGGCAGATATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-509s21c1
Sequence:CCGGTCCTGGCCTTCCTCATGATCTCTCGAGAGATCATGAGGAAGGCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-275s21c1
Sequence:CCGGGAATCACCCACGTTGTGAATGCTCGAGCATTCACAACGTGGGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-344s21c1
Sequence:CCGGGAATGTCCCTGGAGTACTATGCTCGAGCATAGTACTCCAGGGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-611s21c1
Sequence:CCGGAGCTCCAGGTTCTGGACAACCCTCGAGGGTTGTCCAGAACCTGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-317s21c1
Sequence:CCGGTGGACACAGGTGCCAAATTCTCTCGAGAGAATTTGGCACCTGTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016364.x-309s1c1
Sequence:CCGGTGCCACACTGAACCATATCGACTCGAGTCGATATGGTTCAGTGTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016364.x-534s1c1
Sequence:CCGGCTTTCTGCCTGTTGCTCGATACTCGAGTATCGAGCAACAGGCAGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016364.x-987s1c1
Sequence:CCGGGTTCAGTCCATCTCTATAATACTCGAGTATTATAGAGATGGACTGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016364.x-657s1c1
Sequence:CCGGTGAGAACATGACGCTGGTAGACTCGAGTCTACCAGCGTCATGTTCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016364.x-529s1c1
Sequence:CCGGGTCTACTTTCTGCCTGTTGCTCTCGAGAGCAACAGGCAGAAAGTAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016364
DUSP13 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 13
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016364.3-738s21c1
Sequence:CCGGTCTAGTGACCCTGAGATGTAACTCGAGTTACATCTCAGGGTCACTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-576s21c1
Sequence:CCGGCCGCAATATCTGCCCTAACTCCTCGAGGAGTTAGGGCAGATATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-509s21c1
Sequence:CCGGTCCTGGCCTTCCTCATGATCTCTCGAGAGATCATGAGGAAGGCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-275s21c1
Sequence:CCGGGAATCACCCACGTTGTGAATGCTCGAGCATTCACAACGTGGGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-344s21c1
Sequence:CCGGGAATGTCCCTGGAGTACTATGCTCGAGCATAGTACTCCAGGGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-611s21c1
Sequence:CCGGAGCTCCAGGTTCTGGACAACCCTCGAGGGTTGTCCAGAACCTGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016364.3-317s21c1
Sequence:CCGGTGGACACAGGTGCCAAATTCTCTCGAGAGAATTTGGCACCTGTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016364.x-309s1c1
Sequence:CCGGTGCCACACTGAACCATATCGACTCGAGTCGATATGGTTCAGTGTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016364.x-534s1c1
Sequence:CCGGCTTTCTGCCTGTTGCTCGATACTCGAGTATCGAGCAACAGGCAGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016364.x-987s1c1
Sequence:CCGGGTTCAGTCCATCTCTATAATACTCGAGTATTATAGAGATGGACTGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016364.x-657s1c1
Sequence:CCGGTGAGAACATGACGCTGGTAGACTCGAGTCTACCAGCGTCATGTTCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016364.x-529s1c1
Sequence:CCGGGTCTACTTTCTGCCTGTTGCTCTCGAGAGCAACAGGCAGAAAGTAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013849
VALIDATED
DUSP13 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 13
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013849.3-643s21c1
Sequence:CCGGGTGAGTCGCTCTGCCACAATTCTCGAGAATTGTGGCAGAGCGACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013849.3-574s21c1
Sequence:CCGGGTTGCTCGTTACATCAGAGATCTCGAGATCTCTGATGTAACGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013849.3-505s21c1
Sequence:CCGGCCTCTGGAGTACTATGGCATTCTCGAGAATGCCATAGTACTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013849.3-733s21c1
Sequence:CCGGCGAGATATCTGTCCCAACTCACTCGAGTGAGTTGGGACAGATATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013849.3-848s21c1
Sequence:CCGGATCCAGCGTGGCCTAACCTGACTCGAGTCAGGTTAGGCCACGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013849.2-875s1c1
Sequence:CCGGGCCTCTGCTGTTTCCAGAGATCTCGAGATCTCTGGAAACAGCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013849.2-383s1c1
Sequence:CCGGGCCAGAGACAAGGGTCGTCTACTCGAGTAGACGACCCTTGTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013849.2-488s1c1
Sequence:CCGGCCTCTGGAGTACTATGGCATTCTCGAGAATGCCATAGTACTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013849.2-557s1c1
Sequence:CCGGGTTGCTCGTTACATCAGAGATCTCGAGATCTCTGATGTAACGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013849.2-716s1c1
Sequence:CCGGCGAGATATCTGTCCCAACTCACTCGAGTGAGTTGGGACAGATATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013849
VALIDATED
DUSP13 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 13
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013849.3-643s21c1
Sequence:CCGGGTGAGTCGCTCTGCCACAATTCTCGAGAATTGTGGCAGAGCGACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013849.3-574s21c1
Sequence:CCGGGTTGCTCGTTACATCAGAGATCTCGAGATCTCTGATGTAACGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013849.3-505s21c1
Sequence:CCGGCCTCTGGAGTACTATGGCATTCTCGAGAATGCCATAGTACTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013849.3-733s21c1
Sequence:CCGGCGAGATATCTGTCCCAACTCACTCGAGTGAGTTGGGACAGATATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013849.3-848s21c1
Sequence:CCGGATCCAGCGTGGCCTAACCTGACTCGAGTCAGGTTAGGCCACGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013849.2-875s1c1
Sequence:CCGGGCCTCTGCTGTTTCCAGAGATCTCGAGATCTCTGGAAACAGCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013849.2-383s1c1
Sequence:CCGGGCCAGAGACAAGGGTCGTCTACTCGAGTAGACGACCCTTGTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013849.2-488s1c1
Sequence:CCGGCCTCTGGAGTACTATGGCATTCTCGAGAATGCCATAGTACTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013849.2-557s1c1
Sequence:CCGGGTTGCTCGTTACATCAGAGATCTCGAGATCTCTGATGTAACGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013849.2-716s1c1
Sequence:CCGGCGAGATATCTGTCCCAACTCACTCGAGTGAGTTGGGACAGATATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013849
VALIDATED
DUSP13 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 13
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013849.3-643s21c1
Sequence:CCGGGTGAGTCGCTCTGCCACAATTCTCGAGAATTGTGGCAGAGCGACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013849.3-574s21c1
Sequence:CCGGGTTGCTCGTTACATCAGAGATCTCGAGATCTCTGATGTAACGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013849.3-505s21c1
Sequence:CCGGCCTCTGGAGTACTATGGCATTCTCGAGAATGCCATAGTACTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013849.3-733s21c1
Sequence:CCGGCGAGATATCTGTCCCAACTCACTCGAGTGAGTTGGGACAGATATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013849.3-848s21c1
Sequence:CCGGATCCAGCGTGGCCTAACCTGACTCGAGTCAGGTTAGGCCACGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013849.2-875s1c1
Sequence:CCGGGCCTCTGCTGTTTCCAGAGATCTCGAGATCTCTGGAAACAGCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013849.2-383s1c1
Sequence:CCGGGCCAGAGACAAGGGTCGTCTACTCGAGTAGACGACCCTTGTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013849.2-488s1c1
Sequence:CCGGCCTCTGGAGTACTATGGCATTCTCGAGAATGCCATAGTACTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013849.2-557s1c1
Sequence:CCGGGTTGCTCGTTACATCAGAGATCTCGAGATCTCTGATGTAACGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013849.2-716s1c1
Sequence:CCGGCGAGATATCTGTCCCAACTCACTCGAGTGAGTTGGGACAGATATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks