EMAIL THIS PAGE TO A FRIEND

DUSP14

dual specificity phosphatase 14

93 Gene Product Result for
Synonyms: MKP-L MKP6
UniProtKB ID: O95147
Gene ID:
Human(11072) Summary: Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. They have been implicated as major modulators of critical signaling pathways. DUSP14 contains the consensus DUSP C-terminal catalytic domain but lacks the N-terminal CH2 domain found in the MKP (mitogen-activated protein kinase phosphatase) class of DUSPs (see MIM 600714) (summary by Patterson et al., 2009 [PubMed 19228121]
Mouse(56405) dual specificity phosphatase 14
Rat(360580) dual specificity phosphatase 14
domestic guinea pig(100734349) dual specificity phosphatase 14
naked mole-rat(101708431) dual specificity phosphatase 14
sheep(101112145) dual specificity phosphatase 14
Zebrafish(450040) dual specificity phosphatase 14
chicken(417657) dual specificity phosphatase 14
dog(491131) dual specificity phosphatase 14
cow(507294) dual specificity phosphatase 14
domestic cat(101082789) dual specificity phosphatase 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007026 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007026 Rosetta Predictions human pricing
NM_001079893 Rosetta Predictions rat pricing
NM_019819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067277 predicted 439
2 SASI_Hs01_00067278 predicted 361
3 SASI_Hs01_00067279 predicted 817
4 SASI_Hs01_00067281 predicted 826
5 SASI_Hs01_00067282 predicted 468
6 SASI_Hs01_00067283 predicted 565
7 SASI_Hs02_00342790 predicted 463
8 SASI_Hs02_00342791 predicted 1258
9 SASI_Hs02_00342792 predicted 369
10 SASI_Hs02_00342793 predicted 336
11 SASI_Hs01_00067275 predicted 1047
12 SASI_Hs01_00067276 predicted 396
13 SASI_Hs01_00067280 predicted 928
14 SASI_Hs01_00067284 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079893 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208239 predicted 278
2 SASI_Rn02_00208240 predicted 292
3 SASI_Rn02_00208241 predicted 358
4 SASI_Rn02_00208242 predicted 372
5 SASI_Rn02_00208243 predicted 345
6 SASI_Rn02_00208244 predicted 313
7 SASI_Rn02_00208245 predicted 285
8 SASI_Rn02_00208246 predicted 357
9 SASI_Rn02_00208247 predicted 225
10 SASI_Rn02_00208248 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080665 predicted 727
2 SASI_Mm01_00080666 predicted 550
3 SASI_Mm02_00325100 predicted 768
4 SASI_Mm02_00325101 predicted 635
5 SASI_Mm01_00080668 predicted 323
6 SASI_Mm01_00080669 predicted 350
7 SASI_Mm01_00080670 predicted 680
8 SASI_Mm01_00080671 predicted 805
9 SASI_Mm01_00080672 predicted 1157
10 SASI_Mm01_00080673 predicted 420
11 SASI_Mm01_00080667 predicted 908
12 SASI_Mm01_00080674 predicted 1055
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007026
VALIDATED
DUSP14 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 14
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_007026.x-315s1c1
Sequence:CCGGGCTCAAATCACCTCCTCTCTACTCGAGTAGAGAGGAGGTGATTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007026.x-753s1c1
Sequence:CCGGGTACAGACACCTTATGGCATACTCGAGTATGCCATAAGGTGTCTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007026.x-407s1c1
Sequence:CCGGTGCTACCATTGAGATCCCTAACTCGAGTTAGGGATCTCAATGGTAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_007026.x-1409s1c1
Sequence:CCGGGCCCAGGATTATATTAGCATTCTCGAGAATGCTAATATAATCCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007026.2-363s21c1
Sequence:GTACCGGCATAGGAGGCATTGCTCAAATCTCGAGATTTGAGCAATGCCTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007026.2-471s21c1
Sequence:CCGGTACCATTGAGATCCCTAATTTCTCGAGAAATTAGGGATCTCAATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007026.2-789s21c1
Sequence:CCGGCTTTGGGAAGTCGACAGTTAACTCGAGTTAACTGTCGACTTCCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_007026.2-659s21c1
Sequence:CCGGGTATCGCGTACCTGATGAAATCTCGAGATTTCATCAGGTACGCGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_007026.2-1301s21c1
Sequence:CCGGATGCTTAGGGAAGGTTGATAACTCGAGTTATCAACCTTCCCTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007026.2-814s21c1
Sequence:CCGGGTACAGACACCTTATGGCATACTCGAGTATGCCATAAGGTGTCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007026
VALIDATED
DUSP14 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 14
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_007026.x-315s1c1
Sequence:CCGGGCTCAAATCACCTCCTCTCTACTCGAGTAGAGAGGAGGTGATTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007026.x-753s1c1
Sequence:CCGGGTACAGACACCTTATGGCATACTCGAGTATGCCATAAGGTGTCTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007026.x-407s1c1
Sequence:CCGGTGCTACCATTGAGATCCCTAACTCGAGTTAGGGATCTCAATGGTAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_007026.x-1409s1c1
Sequence:CCGGGCCCAGGATTATATTAGCATTCTCGAGAATGCTAATATAATCCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007026.2-363s21c1
Sequence:GTACCGGCATAGGAGGCATTGCTCAAATCTCGAGATTTGAGCAATGCCTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007026.2-471s21c1
Sequence:CCGGTACCATTGAGATCCCTAATTTCTCGAGAAATTAGGGATCTCAATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007026.2-789s21c1
Sequence:CCGGCTTTGGGAAGTCGACAGTTAACTCGAGTTAACTGTCGACTTCCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_007026.2-659s21c1
Sequence:CCGGGTATCGCGTACCTGATGAAATCTCGAGATTTCATCAGGTACGCGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_007026.2-1301s21c1
Sequence:CCGGATGCTTAGGGAAGGTTGATAACTCGAGTTATCAACCTTCCCTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007026.2-814s21c1
Sequence:CCGGGTACAGACACCTTATGGCATACTCGAGTATGCCATAAGGTGTCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007026
VALIDATED
DUSP14 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 14
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_007026.x-315s1c1
Sequence:CCGGGCTCAAATCACCTCCTCTCTACTCGAGTAGAGAGGAGGTGATTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007026.x-753s1c1
Sequence:CCGGGTACAGACACCTTATGGCATACTCGAGTATGCCATAAGGTGTCTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007026.x-407s1c1
Sequence:CCGGTGCTACCATTGAGATCCCTAACTCGAGTTAGGGATCTCAATGGTAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_007026.x-1409s1c1
Sequence:CCGGGCCCAGGATTATATTAGCATTCTCGAGAATGCTAATATAATCCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007026.2-363s21c1
Sequence:GTACCGGCATAGGAGGCATTGCTCAAATCTCGAGATTTGAGCAATGCCTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007026.2-471s21c1
Sequence:CCGGTACCATTGAGATCCCTAATTTCTCGAGAAATTAGGGATCTCAATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007026.2-789s21c1
Sequence:CCGGCTTTGGGAAGTCGACAGTTAACTCGAGTTAACTGTCGACTTCCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_007026.2-659s21c1
Sequence:CCGGGTATCGCGTACCTGATGAAATCTCGAGATTTCATCAGGTACGCGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_007026.2-1301s21c1
Sequence:CCGGATGCTTAGGGAAGGTTGATAACTCGAGTTATCAACCTTCCCTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007026.2-814s21c1
Sequence:CCGGGTACAGACACCTTATGGCATACTCGAGTATGCCATAAGGTGTCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019819
VALIDATED
DUSP14 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 14
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019819.2-635s1c1
Sequence:CCGGCCTCTGTATTGCGTACCTGATCTCGAGATCAGGTACGCAATACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019819.2-841s1c1
Sequence:CCGGCCCGACACTTGATGCCTTATTCTCGAGAATAAGGCATCAAGTGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019819.2-359s1c1
Sequence:CCGGTCAGATCACCTCCTCTCTCTTCTCGAGAAGAGAGAGGAGGTGATCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019819.2-770s1c1
Sequence:CCGGCTTTGGGAAGTCTTCAGTTAACTCGAGTTAACTGAAGACTTCCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019819.2-681s1c1
Sequence:CCGGGAGGCATACAACTGGGTGAAACTCGAGTTTCACCCAGTTGTATGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019819.3-753s21c1
Sequence:CCGGACTACGAGAGCCAGCTCTTTGCTCGAGCAAAGAGCTGGCTCTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019819.3-840s21c1
Sequence:CCGGCCCGACACTTGATGCCTTATTCTCGAGAATAAGGCATCAAGTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019819.3-639s21c1
Sequence:GTACCGGGTATTGCGTACCTGATGAAATCTCGAGATTTCATCAGGTACGCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019819.3-975s21c1
Sequence:CCGGACGCTGGGTGTTCGGGTTTAACTCGAGTTAAACCCGAACACCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019819.3-809s21c1
Sequence:CCGGGGCATCATCCCAGACGTTTATCTCGAGATAAACGTCTGGGATGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019819
VALIDATED
DUSP14 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 14
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019819.2-635s1c1
Sequence:CCGGCCTCTGTATTGCGTACCTGATCTCGAGATCAGGTACGCAATACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019819.2-841s1c1
Sequence:CCGGCCCGACACTTGATGCCTTATTCTCGAGAATAAGGCATCAAGTGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019819.2-359s1c1
Sequence:CCGGTCAGATCACCTCCTCTCTCTTCTCGAGAAGAGAGAGGAGGTGATCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019819.2-770s1c1
Sequence:CCGGCTTTGGGAAGTCTTCAGTTAACTCGAGTTAACTGAAGACTTCCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019819.2-681s1c1
Sequence:CCGGGAGGCATACAACTGGGTGAAACTCGAGTTTCACCCAGTTGTATGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019819.3-753s21c1
Sequence:CCGGACTACGAGAGCCAGCTCTTTGCTCGAGCAAAGAGCTGGCTCTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019819.3-840s21c1
Sequence:CCGGCCCGACACTTGATGCCTTATTCTCGAGAATAAGGCATCAAGTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019819.3-639s21c1
Sequence:GTACCGGGTATTGCGTACCTGATGAAATCTCGAGATTTCATCAGGTACGCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019819.3-975s21c1
Sequence:CCGGACGCTGGGTGTTCGGGTTTAACTCGAGTTAAACCCGAACACCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019819.3-809s21c1
Sequence:CCGGGGCATCATCCCAGACGTTTATCTCGAGATAAACGTCTGGGATGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019819
VALIDATED
DUSP14 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 14
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019819.2-635s1c1
Sequence:CCGGCCTCTGTATTGCGTACCTGATCTCGAGATCAGGTACGCAATACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019819.2-841s1c1
Sequence:CCGGCCCGACACTTGATGCCTTATTCTCGAGAATAAGGCATCAAGTGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019819.2-359s1c1
Sequence:CCGGTCAGATCACCTCCTCTCTCTTCTCGAGAAGAGAGAGGAGGTGATCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019819.2-770s1c1
Sequence:CCGGCTTTGGGAAGTCTTCAGTTAACTCGAGTTAACTGAAGACTTCCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019819.2-681s1c1
Sequence:CCGGGAGGCATACAACTGGGTGAAACTCGAGTTTCACCCAGTTGTATGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019819.3-753s21c1
Sequence:CCGGACTACGAGAGCCAGCTCTTTGCTCGAGCAAAGAGCTGGCTCTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019819.3-840s21c1
Sequence:CCGGCCCGACACTTGATGCCTTATTCTCGAGAATAAGGCATCAAGTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019819.3-639s21c1
Sequence:GTACCGGGTATTGCGTACCTGATGAAATCTCGAGATTTCATCAGGTACGCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019819.3-975s21c1
Sequence:CCGGACGCTGGGTGTTCGGGTTTAACTCGAGTTAAACCCGAACACCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019819.3-809s21c1
Sequence:CCGGGGCATCATCCCAGACGTTTATCTCGAGATAAACGTCTGGGATGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks