EMAIL THIS PAGE TO A FRIEND

DUSP15

dual specificity phosphatase 15

83 Gene Product Result for
Synonyms: VHY
Gene ID:
Human(128853) Summary: The protein encoded by this gene belongs to the non-receptor class of the protein-tyrosine phosphatase family. The encoded protein has both protein-tyrosine phophatase activity and serine/threonine-specific phosphatase activity, and therefore is known as a dual specificity phosphatase. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(252864) dual specificity phosphatase-like 15
Rat(362238) dual specificity phosphatase 15
domestic guinea pig(100722755) dual specificity phosphatase 15
naked mole-rat(101711111) dual specificity phosphatase 15
chicken(419277) dual specificity phosphatase 15
cow(618412) dual specificity phosphatase 15
Horse(100068483) dual specificity phosphatase 15
domestic cat(101080521) dual specificity phosphatase 15
dog(609828) dual specificity phosphatase 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080611 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145744 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145744 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145744 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012644 Rosetta Predictions human pricing
NM_080611 Rosetta Predictions human pricing
NM_177991 Rosetta Predictions human pricing
NM_001108598 Rosetta Predictions rat pricing
NM_145744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221762 predicted 553
2 SASI_Hs01_00221763 predicted 856
3 SASI_Hs01_00221764 predicted 519
4 SASI_Hs01_00221765 predicted 809
5 SASI_Hs01_00221766 predicted 498
6 SASI_Hs01_00221767 predicted 557
7 SASI_Hs01_00221768 predicted 552
8 SASI_Hs02_00306199 predicted 574
9 SASI_Hs01_00221769 predicted 500
10 SASI_Hs01_00221770 predicted 813
11 SASI_Hs01_00221771 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106188 predicted 721
2 SASI_Hs01_00106189 predicted 617
3 SASI_Hs01_00106190 predicted 1034
4 SASI_Hs02_00362357 predicted 630
5 SASI_Hs01_00106193 predicted 986
6 SASI_Hs01_00106194 predicted 671
7 SASI_Hs02_00362358 predicted 721
8 SASI_Hs02_00362359 predicted 982
9 SASI_Hs01_00106195 predicted 982
10 SASI_Hs01_00106196 predicted 609
11 SASI_Hs01_00106187 predicted 631
12 SASI_Hs01_00106191 predicted 559
13 SASI_Hs01_00106192 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049175 predicted 528
2 SASI_Hs01_00049176 predicted 836
3 SASI_Hs01_00049177 predicted 494
4 SASI_Hs01_00049178 predicted 786
5 SASI_Hs01_00049179 predicted 470
6 SASI_Hs01_00049180 predicted 528
7 SASI_Hs01_00049181 predicted 520
8 SASI_Hs02_00369464 predicted 546
9 SASI_Hs01_00049182 predicted 471
10 SASI_Hs01_00049183 predicted 786
11 SASI_Hs01_00049184 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108598 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240219 predicted 1000
2 SASI_Rn02_00240220 predicted 954
3 SASI_Rn02_00240221 predicted 689
4 SASI_Rn02_00240222 predicted 689
5 SASI_Rn02_00240223 predicted 914
6 SASI_Rn02_00240224 predicted 806
7 SASI_Rn02_00240225 predicted 1031
8 SASI_Rn02_00240226 predicted 911
9 SASI_Rn02_00240227 predicted 950
10 SASI_Rn02_00240228 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125629 predicted 213
2 SASI_Mm01_00125630 predicted 300
3 SASI_Mm01_00125631 predicted 247
4 SASI_Mm01_00125632 predicted 200
5 SASI_Mm01_00125633 predicted 249
6 SASI_Mm01_00125634 predicted 221
7 SASI_Mm01_00125635 predicted 301
8 SASI_Mm01_00125636 predicted 247
9 SASI_Mm01_00125637 predicted 242
10 SASI_Mm01_00125638 predicted 214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080611
DUSP15 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 15
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080611.3-626s21c1
Sequence:CCGGCCACGATTGTGACAGCGTATGCTCGAGCATACGCTGTCACAATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080611.3-374s21c1
Sequence:CCGGTCTACCTCGGAAACTTCATTGCTCGAGCAATGAAGTTTCCGAGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080611.3-408s21c1
Sequence:CCGGGGATCAGCTGGGCCGAAATAACTCGAGTTATTTCGGCCCAGCTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080611.3-559s21c1
Sequence:CCGGATCCACTGCTGCCGCCTTAATCTCGAGATTAAGGCGGCAGCAGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080611.x-1349s1c1
Sequence:CCGGAGGGTATTAAAGAGACACAGACTCGAGTCTGTGTCTCTTTAATACCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080611.x-557s1c1
Sequence:CCGGTCATCCACTGCTGCCGCCTTACTCGAGTAAGGCGGCAGCAGTGGATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080611.x-415s1c1
Sequence:CCGGCTGGGCCGAAATAAGATCACACTCGAGTGTGATCTTATTTCGGCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080611.x-419s1c1
Sequence:CCGGGCCGAAATAAGATCACACACACTCGAGTGTGTGTGATCTTATTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080611.x-369s1c1
Sequence:CCGGTGGACTCTACCTCGGAAACTTCTCGAGAAGTTTCCGAGGTAGAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080611
DUSP15 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 15
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080611.3-626s21c1
Sequence:CCGGCCACGATTGTGACAGCGTATGCTCGAGCATACGCTGTCACAATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080611.3-374s21c1
Sequence:CCGGTCTACCTCGGAAACTTCATTGCTCGAGCAATGAAGTTTCCGAGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080611.3-408s21c1
Sequence:CCGGGGATCAGCTGGGCCGAAATAACTCGAGTTATTTCGGCCCAGCTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080611.3-559s21c1
Sequence:CCGGATCCACTGCTGCCGCCTTAATCTCGAGATTAAGGCGGCAGCAGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080611.x-1349s1c1
Sequence:CCGGAGGGTATTAAAGAGACACAGACTCGAGTCTGTGTCTCTTTAATACCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080611.x-557s1c1
Sequence:CCGGTCATCCACTGCTGCCGCCTTACTCGAGTAAGGCGGCAGCAGTGGATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080611.x-415s1c1
Sequence:CCGGCTGGGCCGAAATAAGATCACACTCGAGTGTGATCTTATTTCGGCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080611.x-419s1c1
Sequence:CCGGGCCGAAATAAGATCACACACACTCGAGTGTGTGTGATCTTATTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080611.x-369s1c1
Sequence:CCGGTGGACTCTACCTCGGAAACTTCTCGAGAAGTTTCCGAGGTAGAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080611
DUSP15 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 15
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080611.3-626s21c1
Sequence:CCGGCCACGATTGTGACAGCGTATGCTCGAGCATACGCTGTCACAATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080611.3-374s21c1
Sequence:CCGGTCTACCTCGGAAACTTCATTGCTCGAGCAATGAAGTTTCCGAGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080611.3-408s21c1
Sequence:CCGGGGATCAGCTGGGCCGAAATAACTCGAGTTATTTCGGCCCAGCTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080611.3-559s21c1
Sequence:CCGGATCCACTGCTGCCGCCTTAATCTCGAGATTAAGGCGGCAGCAGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080611.x-1349s1c1
Sequence:CCGGAGGGTATTAAAGAGACACAGACTCGAGTCTGTGTCTCTTTAATACCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080611.x-557s1c1
Sequence:CCGGTCATCCACTGCTGCCGCCTTACTCGAGTAAGGCGGCAGCAGTGGATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080611.x-415s1c1
Sequence:CCGGCTGGGCCGAAATAAGATCACACTCGAGTGTGATCTTATTTCGGCCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080611.x-419s1c1
Sequence:CCGGGCCGAAATAAGATCACACACACTCGAGTGTGTGTGATCTTATTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080611.x-369s1c1
Sequence:CCGGTGGACTCTACCTCGGAAACTTCTCGAGAAGTTTCCGAGGTAGAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145744
DUSP15 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145744.1-384s1c1
Sequence:CCGGCATCCCATGACATCTCACCAACTCGAGTTGGTGAGATGTCATGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145744.1-250s1c1
Sequence:CCGGTCAAAGAATGCGTCCACTTTACTCGAGTAAAGTGGACGCATTCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145744.1-248s1c1
Sequence:CCGGCTTCAAAGAATGCGTCCACTTCTCGAGAAGTGGACGCATTCTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145744.1-309s1c1
Sequence:CCGGCACTGGCCTTTGAAGCATGAACTCGAGTTCATGCTTCAAAGGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145744.1-131s1c1
Sequence:CCGGCCGGAATAAGATCACACATATCTCGAGATATGTGTGATCTTATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145744
DUSP15 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145744.1-384s1c1
Sequence:CCGGCATCCCATGACATCTCACCAACTCGAGTTGGTGAGATGTCATGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145744.1-250s1c1
Sequence:CCGGTCAAAGAATGCGTCCACTTTACTCGAGTAAAGTGGACGCATTCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145744.1-248s1c1
Sequence:CCGGCTTCAAAGAATGCGTCCACTTCTCGAGAAGTGGACGCATTCTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145744.1-309s1c1
Sequence:CCGGCACTGGCCTTTGAAGCATGAACTCGAGTTCATGCTTCAAAGGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145744.1-131s1c1
Sequence:CCGGCCGGAATAAGATCACACATATCTCGAGATATGTGTGATCTTATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145744
DUSP15 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145744.1-384s1c1
Sequence:CCGGCATCCCATGACATCTCACCAACTCGAGTTGGTGAGATGTCATGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145744.1-250s1c1
Sequence:CCGGTCAAAGAATGCGTCCACTTTACTCGAGTAAAGTGGACGCATTCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145744.1-248s1c1
Sequence:CCGGCTTCAAAGAATGCGTCCACTTCTCGAGAAGTGGACGCATTCTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145744.1-309s1c1
Sequence:CCGGCACTGGCCTTTGAAGCATGAACTCGAGTTCATGCTTCAAAGGCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145744.1-131s1c1
Sequence:CCGGCCGGAATAAGATCACACATATCTCGAGATATGTGTGATCTTATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks