EMAIL THIS PAGE TO A FRIEND

DUSP16

dual specificity phosphatase 16

143 Gene Product Result for
Synonyms: MKP-7 MKP7
UniProtKB ID: Q9BY84, Q547C7, Q9C0G3
Gene ID:
Human(80824) Summary: This gene encodes a mitogen-activated protein kinase phosphatase that is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. The encoded protein specifically regulates the c-Jun amino-terminal kinase (JNK) and extracellular signal-regulated kinase (ERK) pathways.[provided by RefSeq, May 2010]
Mouse(70686) dual specificity phosphatase 16
Rat(297682) dual specificity phosphatase 16
Zebrafish(406523) dual specificity phosphatase 16
domestic cat(101091792) dual specificity phosphatase 16
cow(618644) dual specificity phosphatase 16
Horse(100063475) dual specificity phosphatase 16
dog(486683) dual specificity phosphatase 16
chicken(431336) dual specificity phosphatase 16
sheep(101118942) dual specificity phosphatase 16
naked mole-rat(101700389) dual specificity phosphatase 16
domestic guinea pig(100728615) dual specificity phosphatase 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030640 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001048054 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001048054 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001048054 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030640 Rosetta Predictions human pricing
NM_001106624 Rosetta Predictions rat pricing
NM_001048054 Rosetta Predictions mouse pricing
NM_130447 Rosetta Predictions mouse pricing
NM_181320 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176420 predicted 938
2 SASI_Hs01_00176421 predicted 633
3 SASI_Hs01_00176422 predicted 818
4 SASI_Hs01_00176423 predicted 1466
5 SASI_Hs01_00176424 predicted 1199
6 SASI_Hs01_00176425 predicted 1458
7 SASI_Hs01_00176426 predicted 1347
8 SASI_Hs01_00176427 predicted 843
9 SASI_Hs01_00176428 predicted 1897
10 SASI_Hs02_00358216 predicted 884
11 SASI_Hs01_00176429 predicted 1840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220778 predicted 449
2 SASI_Rn02_00220779 predicted 547
3 SASI_Rn02_00220780 predicted 1113
4 SASI_Rn02_00220781 predicted 1193
5 SASI_Rn02_00220782 predicted 2326
6 SASI_Rn02_00220783 predicted 365
7 SASI_Rn02_00220784 predicted 835
8 SASI_Rn02_00220785 predicted 2354
9 SASI_Rn02_00220786 predicted 2234
10 SASI_Rn02_00220787 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291961 predicted 762
2 SASI_Mm02_00291962 predicted 918
3 SASI_Mm02_00291963 predicted 805
4 SASI_Mm02_00291964 predicted 1152
5 SASI_Mm02_00291965 predicted 924
6 SASI_Mm02_00291966 predicted 1282
7 SASI_Mm02_00291967 predicted 1191
8 SASI_Mm02_00291968 predicted 1149
9 SASI_Mm02_00291969 predicted 729
10 SASI_Mm02_00291970 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338244 predicted 760
2 SASI_Mm01_00081047 predicted 912
3 SASI_Mm02_00338245 predicted 802
4 SASI_Mm01_00081050 predicted 1157
5 SASI_Mm01_00081052 predicted 924
6 SASI_Mm02_00338246 predicted 1282
7 SASI_Mm02_00338247 predicted 1185
8 SASI_Mm02_00338248 predicted 1141
9 SASI_Mm02_00338249 predicted 724
10 SASI_Mm02_00338250 predicted 1169
11 SASI_Mm01_00081045 predicted 1392
12 SASI_Mm01_00081046 predicted 1855
13 SASI_Mm01_00081048 predicted 1437
14 SASI_Mm01_00081049 predicted 1747
15 SASI_Mm01_00081051 predicted 1637
16 SASI_Mm01_00081053 predicted 2545
17 SASI_Mm01_00081054 predicted 2517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024452 predicted 468
2 SASI_Mm01_00024453 predicted 663
3 SASI_Mm01_00024454 predicted 1149
4 SASI_Mm01_00024455 predicted 1141
5 SASI_Mm01_00024456 predicted 903
6 SASI_Mm01_00024457 predicted 1125
7 SASI_Mm01_00024458 predicted 675
8 SASI_Mm01_00024459 predicted 711
9 SASI_Mm01_00024460 predicted 1133
10 SASI_Mm01_00024461 predicted 640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181320
VALIDATED
DUSP16 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181320.2-2692s1c1
Sequence:CCGGGCGGATCTAATGGAGGCATTTCTCGAGAAATGCCTCCATTAGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181320.2-540s1c1
Sequence:CCGGGCTAATTGATAGCCGACCATTCTCGAGAATGGTCGGCTATCAATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181320.2-539s1c1
Sequence:CCGGTGCTAATTGATAGCCGACCATCTCGAGATGGTCGGCTATCAATTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181320.2-676s1c1
Sequence:CCGGGCAAAGCATAAGGTTGACATTCTCGAGAATGTCAACCTTATGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181320.2-934s1c1
Sequence:CCGGCCAACTCGAATTCTTCCCAATCTCGAGATTGGGAAGAATTCGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181320
VALIDATED
DUSP16 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181320.2-2692s1c1
Sequence:CCGGGCGGATCTAATGGAGGCATTTCTCGAGAAATGCCTCCATTAGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181320.2-540s1c1
Sequence:CCGGGCTAATTGATAGCCGACCATTCTCGAGAATGGTCGGCTATCAATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181320.2-539s1c1
Sequence:CCGGTGCTAATTGATAGCCGACCATCTCGAGATGGTCGGCTATCAATTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181320.2-676s1c1
Sequence:CCGGGCAAAGCATAAGGTTGACATTCTCGAGAATGTCAACCTTATGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181320.2-934s1c1
Sequence:CCGGCCAACTCGAATTCTTCCCAATCTCGAGATTGGGAAGAATTCGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181320
VALIDATED
DUSP16 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181320.2-2692s1c1
Sequence:CCGGGCGGATCTAATGGAGGCATTTCTCGAGAAATGCCTCCATTAGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181320.2-540s1c1
Sequence:CCGGGCTAATTGATAGCCGACCATTCTCGAGAATGGTCGGCTATCAATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181320.2-539s1c1
Sequence:CCGGTGCTAATTGATAGCCGACCATCTCGAGATGGTCGGCTATCAATTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181320.2-676s1c1
Sequence:CCGGGCAAAGCATAAGGTTGACATTCTCGAGAATGTCAACCTTATGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181320.2-934s1c1
Sequence:CCGGCCAACTCGAATTCTTCCCAATCTCGAGATTGGGAAGAATTCGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030640
VALIDATED
DUSP16 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 16
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_030640.1-1335s1c1
Sequence:CCGGGCCTCCAATGGATGTGTTCTACTCGAGTAGAACACATCCATTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030640.1-725s1c1
Sequence:CCGGCCGGCCATTTGTGGAATACAACTCGAGTTGTATTCCACAAATGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_030640.1-806s1c1
Sequence:CCGGGCAACAGGACAAAGTGTTAATCTCGAGATTAACACTTTGTCCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_030640.1-1111s1c1
Sequence:CCGGCCCGAATTCTTCCCAATCTTTCTCGAGAAAGATTGGGAAGAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_030640.1-1897s1c1
Sequence:CCGGCATCAGAAGATGCTTTGGAATCTCGAGATTCCAAAGCATCTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030640.1-2982s21c1
Sequence:GTACCGGGATCTCAAATATTAGTCTTTGCTCGAGCAAAGACTAATATTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030640.1-806s21c1
Sequence:CCGGGCAACAGGACAAAGTGTTAATCTCGAGATTAACACTTTGTCCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030640.1-1111s21c1
Sequence:CCGGCCCGAATTCTTCCCAATCTTTCTCGAGAAAGATTGGGAAGAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_030640.1-1335s21c1
Sequence:CCGGGCCTCCAATGGATGTGTTCTACTCGAGTAGAACACATCCATTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030640.1-1897s21c1
Sequence:CCGGCATCAGAAGATGCTTTGGAATCTCGAGATTCCAAAGCATCTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030640.1-2800s21c1
Sequence:CCGGCATTTGAGAGATCAGCTAATACTCGAGTATTAGCTGATCTCTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030640
VALIDATED
DUSP16 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 16
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_030640.1-1335s1c1
Sequence:CCGGGCCTCCAATGGATGTGTTCTACTCGAGTAGAACACATCCATTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030640.1-725s1c1
Sequence:CCGGCCGGCCATTTGTGGAATACAACTCGAGTTGTATTCCACAAATGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_030640.1-806s1c1
Sequence:CCGGGCAACAGGACAAAGTGTTAATCTCGAGATTAACACTTTGTCCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_030640.1-1111s1c1
Sequence:CCGGCCCGAATTCTTCCCAATCTTTCTCGAGAAAGATTGGGAAGAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_030640.1-1897s1c1
Sequence:CCGGCATCAGAAGATGCTTTGGAATCTCGAGATTCCAAAGCATCTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030640.1-2982s21c1
Sequence:GTACCGGGATCTCAAATATTAGTCTTTGCTCGAGCAAAGACTAATATTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030640.1-806s21c1
Sequence:CCGGGCAACAGGACAAAGTGTTAATCTCGAGATTAACACTTTGTCCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030640.1-1111s21c1
Sequence:CCGGCCCGAATTCTTCCCAATCTTTCTCGAGAAAGATTGGGAAGAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_030640.1-1335s21c1
Sequence:CCGGGCCTCCAATGGATGTGTTCTACTCGAGTAGAACACATCCATTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030640.1-1897s21c1
Sequence:CCGGCATCAGAAGATGCTTTGGAATCTCGAGATTCCAAAGCATCTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030640.1-2800s21c1
Sequence:CCGGCATTTGAGAGATCAGCTAATACTCGAGTATTAGCTGATCTCTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030640
VALIDATED
DUSP16 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 16
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_030640.1-1335s1c1
Sequence:CCGGGCCTCCAATGGATGTGTTCTACTCGAGTAGAACACATCCATTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030640.1-725s1c1
Sequence:CCGGCCGGCCATTTGTGGAATACAACTCGAGTTGTATTCCACAAATGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_030640.1-806s1c1
Sequence:CCGGGCAACAGGACAAAGTGTTAATCTCGAGATTAACACTTTGTCCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_030640.1-1111s1c1
Sequence:CCGGCCCGAATTCTTCCCAATCTTTCTCGAGAAAGATTGGGAAGAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_030640.1-1897s1c1
Sequence:CCGGCATCAGAAGATGCTTTGGAATCTCGAGATTCCAAAGCATCTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030640.1-2982s21c1
Sequence:GTACCGGGATCTCAAATATTAGTCTTTGCTCGAGCAAAGACTAATATTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030640.1-806s21c1
Sequence:CCGGGCAACAGGACAAAGTGTTAATCTCGAGATTAACACTTTGTCCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030640.1-1111s21c1
Sequence:CCGGCCCGAATTCTTCCCAATCTTTCTCGAGAAAGATTGGGAAGAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_030640.1-1335s21c1
Sequence:CCGGGCCTCCAATGGATGTGTTCTACTCGAGTAGAACACATCCATTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030640.1-1897s21c1
Sequence:CCGGCATCAGAAGATGCTTTGGAATCTCGAGATTCCAAAGCATCTTCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030640.1-2800s21c1
Sequence:CCGGCATTTGAGAGATCAGCTAATACTCGAGTATTAGCTGATCTCTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001048054
VALIDATED
DUSP16 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048054.1-795s21c1
Sequence:CCGGCTAATTGATAGCCGACCATTTCTCGAGAAATGGTCGGCTATCAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048054.1-931s21c1
Sequence:GTACCGGCAAAGCATAAGGTTGACATTGCTCGAGCAATGTCAACCTTATGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048054.1-884s21c1
Sequence:GTACCGGGTTGCAACAGGACAAAGTATTCTCGAGAATACTTTGTCCTGTTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048054.1-956s21c1
Sequence:CCGGCAATCAGAAGGTGGTAGTTTACTCGAGTAAACTACCACCTTCTGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048054.1-2796s21c1
Sequence:CCGGGGTATGCAACGAGGGTAATATCTCGAGATATTACCCTCGTTGCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001048054
VALIDATED
DUSP16 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048054.1-795s21c1
Sequence:CCGGCTAATTGATAGCCGACCATTTCTCGAGAAATGGTCGGCTATCAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048054.1-931s21c1
Sequence:GTACCGGCAAAGCATAAGGTTGACATTGCTCGAGCAATGTCAACCTTATGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048054.1-884s21c1
Sequence:GTACCGGGTTGCAACAGGACAAAGTATTCTCGAGAATACTTTGTCCTGTTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048054.1-956s21c1
Sequence:CCGGCAATCAGAAGGTGGTAGTTTACTCGAGTAAACTACCACCTTCTGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048054.1-2796s21c1
Sequence:CCGGGGTATGCAACGAGGGTAATATCTCGAGATATTACCCTCGTTGCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001048054
VALIDATED
DUSP16 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048054.1-795s21c1
Sequence:CCGGCTAATTGATAGCCGACCATTTCTCGAGAAATGGTCGGCTATCAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048054.1-931s21c1
Sequence:GTACCGGCAAAGCATAAGGTTGACATTGCTCGAGCAATGTCAACCTTATGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048054.1-884s21c1
Sequence:GTACCGGGTTGCAACAGGACAAAGTATTCTCGAGAATACTTTGTCCTGTTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048054.1-956s21c1
Sequence:CCGGCAATCAGAAGGTGGTAGTTTACTCGAGTAAACTACCACCTTCTGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001048054.1-2796s21c1
Sequence:CCGGGGTATGCAACGAGGGTAATATCTCGAGATATTACCCTCGTTGCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks