EMAIL THIS PAGE TO A FRIEND

DUSP18

dual specificity phosphatase 18

79 Gene Product Result for
Synonyms: DSP18 DUSP20 LMWDSP20 bK963H5.1
UniProtKB ID: Q8NEJ0, B3KPA4
Gene ID:
Human(150290) Summary: Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. They have been implicated as major modulators of critical signaling pathways. DUSP18 contains the consensus DUSP C-terminal catalytic domain but lacks the N-terminal CH2 domain found in the MKP (mitogen-activated protein kinase phosphatase) class of DUSPs (see MIM 600714) (summary by Patterson et al., 2009 [PubMed 19228121]
Mouse(75219) dual specificity phosphatase 18
Rat(305477) dual specificity phosphatase 18
domestic guinea pig(100733921) dual specificity phosphatase 18
naked mole-rat(101722746) dual specificity phosphatase 18
sheep(101102676) dual specificity phosphatase 18
chicken(417005) dual specificity phosphatase 18
domestic cat(101093805) dual specificity phosphatase 18
dog(486357) dual specificity phosphatase 18
cow(505912) dual specificity phosphatase 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173745 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173745 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173745 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152511 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115121 MISSION® esiRNA esiRNA human DUSP18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152511 Rosetta Predictions human pricing
NM_001013128 Rosetta Predictions rat pricing
NM_173745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186947 predicted 644
2 SASI_Hs01_00186948 predicted 628
3 SASI_Hs01_00186949 predicted 746
4 SASI_Hs01_00186950 predicted 1008
5 SASI_Hs01_00186951 predicted 507
6 SASI_Hs01_00186952 predicted 721
7 SASI_Hs01_00186954 predicted 959
8 SASI_Hs01_00186955 predicted 899
9 SASI_Hs01_00186956 predicted 780
10 SASI_Hs02_00366293 predicted 854
11 SASI_Hs01_00186953 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013128 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118564 predicted 1119
2 SASI_Rn01_00118565 predicted 373
3 SASI_Rn01_00118566 predicted 350
4 SASI_Rn01_00118567 predicted 330
5 SASI_Rn01_00118568 predicted 343
6 SASI_Rn01_00118569 predicted 1105
7 SASI_Rn02_00200837 predicted 667
8 SASI_Rn01_00118570 predicted 695
9 SASI_Rn01_00118571 predicted 313
10 SASI_Rn02_00200838 predicted 323
11 SASI_Rn01_00118572 predicted 890
12 SASI_Rn01_00118573 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059836 predicted 424
2 SASI_Mm01_00059837 predicted 848
3 SASI_Mm01_00059838 predicted 470
4 SASI_Mm01_00059839 predicted 479
5 SASI_Mm01_00059840 predicted 791
6 SASI_Mm01_00059841 predicted 420
7 SASI_Mm01_00059842 predicted 1167
8 SASI_Mm01_00059843 predicted 1050
9 SASI_Mm01_00059844 predicted 1023
10 SASI_Mm01_00059845 predicted 540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173745
VALIDATED
DUSP18 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 18
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-895s21c1
Sequence:CCGGGTTTGATGATCCCACTGTAAGCTCGAGCTTACAGTGGGATCATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-840s21c1
Sequence:CCGGCAGATGATGGACTCGCCAATGCTCGAGCATTGGCGAGTCCATCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-526s21c1
Sequence:CCGGTCTACGAGGATATCCAGTATGCTCGAGCATACTGGATATCCTCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-805s21c1
Sequence:CCGGATTACGAGTTGCAGCTCTTTGCTCGAGCAAAGAGCTGCAACTCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-413s21c1
Sequence:CCGGGATCACCAAGAGCCTGTTTATCTCGAGATAAACAGGCTCTTGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-749s21c1
Sequence:CCGGCAAGTCATGCAGGCCCATCATCTCGAGATGATGGGCCTGCATGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-574s21c1
Sequence:CCGGTCGCACGCCTCTCCAATTTCTCTCGAGAGAAATTGGAGAGGCGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173745.3-695s1c1
Sequence:CCGGCCTCATGAAGTACCATGCCATCTCGAGATGGCATGGTACTTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173745.3-458s1c1
Sequence:CCGGCCTACTGTCCAGCAATCAGATCTCGAGATCTGATTGCTGGACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173745.3-797s1c1
Sequence:CCGGCCATTACGAGTTGCAGCTCTTCTCGAGAAGAGCTGCAACTCGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173745.3-1350s1c1
Sequence:CCGGCCCAGAAACAAATCTGCCAAACTCGAGTTTGGCAGATTTGTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173745.3-494s1c1
Sequence:CCGGCGTCTCAGTAGAGGTAGCAAACTCGAGTTTGCTACCTCTACTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173745
VALIDATED
DUSP18 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 18
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-895s21c1
Sequence:CCGGGTTTGATGATCCCACTGTAAGCTCGAGCTTACAGTGGGATCATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-840s21c1
Sequence:CCGGCAGATGATGGACTCGCCAATGCTCGAGCATTGGCGAGTCCATCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-526s21c1
Sequence:CCGGTCTACGAGGATATCCAGTATGCTCGAGCATACTGGATATCCTCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-805s21c1
Sequence:CCGGATTACGAGTTGCAGCTCTTTGCTCGAGCAAAGAGCTGCAACTCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-413s21c1
Sequence:CCGGGATCACCAAGAGCCTGTTTATCTCGAGATAAACAGGCTCTTGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-749s21c1
Sequence:CCGGCAAGTCATGCAGGCCCATCATCTCGAGATGATGGGCCTGCATGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-574s21c1
Sequence:CCGGTCGCACGCCTCTCCAATTTCTCTCGAGAGAAATTGGAGAGGCGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173745.3-695s1c1
Sequence:CCGGCCTCATGAAGTACCATGCCATCTCGAGATGGCATGGTACTTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173745.3-458s1c1
Sequence:CCGGCCTACTGTCCAGCAATCAGATCTCGAGATCTGATTGCTGGACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173745.3-797s1c1
Sequence:CCGGCCATTACGAGTTGCAGCTCTTCTCGAGAAGAGCTGCAACTCGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173745.3-1350s1c1
Sequence:CCGGCCCAGAAACAAATCTGCCAAACTCGAGTTTGGCAGATTTGTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173745.3-494s1c1
Sequence:CCGGCGTCTCAGTAGAGGTAGCAAACTCGAGTTTGCTACCTCTACTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173745
VALIDATED
DUSP18 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 18
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-895s21c1
Sequence:CCGGGTTTGATGATCCCACTGTAAGCTCGAGCTTACAGTGGGATCATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-840s21c1
Sequence:CCGGCAGATGATGGACTCGCCAATGCTCGAGCATTGGCGAGTCCATCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-526s21c1
Sequence:CCGGTCTACGAGGATATCCAGTATGCTCGAGCATACTGGATATCCTCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-805s21c1
Sequence:CCGGATTACGAGTTGCAGCTCTTTGCTCGAGCAAAGAGCTGCAACTCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-413s21c1
Sequence:CCGGGATCACCAAGAGCCTGTTTATCTCGAGATAAACAGGCTCTTGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-749s21c1
Sequence:CCGGCAAGTCATGCAGGCCCATCATCTCGAGATGATGGGCCTGCATGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173745.5-574s21c1
Sequence:CCGGTCGCACGCCTCTCCAATTTCTCTCGAGAGAAATTGGAGAGGCGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173745.3-695s1c1
Sequence:CCGGCCTCATGAAGTACCATGCCATCTCGAGATGGCATGGTACTTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173745.3-458s1c1
Sequence:CCGGCCTACTGTCCAGCAATCAGATCTCGAGATCTGATTGCTGGACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173745.3-797s1c1
Sequence:CCGGCCATTACGAGTTGCAGCTCTTCTCGAGAAGAGCTGCAACTCGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_173745.3-1350s1c1
Sequence:CCGGCCCAGAAACAAATCTGCCAAACTCGAGTTTGGCAGATTTGTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173745.3-494s1c1
Sequence:CCGGCGTCTCAGTAGAGGTAGCAAACTCGAGTTTGCTACCTCTACTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152511
VALIDATED
DUSP18 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 18
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152511.3-1566s21c1
Sequence:CCGGTGCTTCCACCTTCACTATAAGCTCGAGCTTATAGTGAAGGTGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152511.3-955s21c1
Sequence:CCGGATCCACTATGAGTTCCAATTGCTCGAGCAATTGGAACTCATAGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152511.3-784s21c1
Sequence:CCGGATGAAGCAGGGCCGTACTTTGCTCGAGCAAAGTACGGCCCTGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152511.3-739s21c1
Sequence:CCGGTGTGACTTCTTTGACCCTATTCTCGAGAATAGGGTCAAAGAAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_152511.x-845s1c1
Sequence:CCGGGCCTCGCCTACCTCATGAAGTCTCGAGACTTCATGAGGTAGGCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_152511.x-738s1c1
Sequence:CCGGCTGTGACTTCTTTGACCCTATCTCGAGATAGGGTCAAAGAAGTCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152511.x-1046s1c1
Sequence:CCGGTCCGTTTGATGATTCCACTGTCTCGAGACAGTGGAATCATCAAACGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152511.x-747s1c1
Sequence:CCGGCTTTGACCCTATTGCTGACCACTCGAGTGGTCAGCAATAGGGTCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152511.x-1483s1c1
Sequence:CCGGGCTTCTTACAGTGAGTGCCAACTCGAGTTGGCACTCACTGTAAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152511
VALIDATED
DUSP18 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 18
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152511.3-1566s21c1
Sequence:CCGGTGCTTCCACCTTCACTATAAGCTCGAGCTTATAGTGAAGGTGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152511.3-955s21c1
Sequence:CCGGATCCACTATGAGTTCCAATTGCTCGAGCAATTGGAACTCATAGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152511.3-784s21c1
Sequence:CCGGATGAAGCAGGGCCGTACTTTGCTCGAGCAAAGTACGGCCCTGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152511.3-739s21c1
Sequence:CCGGTGTGACTTCTTTGACCCTATTCTCGAGAATAGGGTCAAAGAAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_152511.x-845s1c1
Sequence:CCGGGCCTCGCCTACCTCATGAAGTCTCGAGACTTCATGAGGTAGGCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_152511.x-738s1c1
Sequence:CCGGCTGTGACTTCTTTGACCCTATCTCGAGATAGGGTCAAAGAAGTCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152511.x-1046s1c1
Sequence:CCGGTCCGTTTGATGATTCCACTGTCTCGAGACAGTGGAATCATCAAACGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152511.x-747s1c1
Sequence:CCGGCTTTGACCCTATTGCTGACCACTCGAGTGGTCAGCAATAGGGTCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152511.x-1483s1c1
Sequence:CCGGGCTTCTTACAGTGAGTGCCAACTCGAGTTGGCACTCACTGTAAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152511
VALIDATED
DUSP18 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 18
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152511.3-1566s21c1
Sequence:CCGGTGCTTCCACCTTCACTATAAGCTCGAGCTTATAGTGAAGGTGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152511.3-955s21c1
Sequence:CCGGATCCACTATGAGTTCCAATTGCTCGAGCAATTGGAACTCATAGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152511.3-784s21c1
Sequence:CCGGATGAAGCAGGGCCGTACTTTGCTCGAGCAAAGTACGGCCCTGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152511.3-739s21c1
Sequence:CCGGTGTGACTTCTTTGACCCTATTCTCGAGAATAGGGTCAAAGAAGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_152511.x-845s1c1
Sequence:CCGGGCCTCGCCTACCTCATGAAGTCTCGAGACTTCATGAGGTAGGCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_152511.x-738s1c1
Sequence:CCGGCTGTGACTTCTTTGACCCTATCTCGAGATAGGGTCAAAGAAGTCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152511.x-1046s1c1
Sequence:CCGGTCCGTTTGATGATTCCACTGTCTCGAGACAGTGGAATCATCAAACGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152511.x-747s1c1
Sequence:CCGGCTTTGACCCTATTGCTGACCACTCGAGTGGTCAGCAATAGGGTCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152511.x-1483s1c1
Sequence:CCGGGCTTCTTACAGTGAGTGCCAACTCGAGTTGGCACTCACTGTAAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks