EMAIL THIS PAGE TO A FRIEND

DUSP19

dual specificity phosphatase 19

89 Gene Product Result for
Synonyms: DUSP17 LMWDSP3 SKRP1 TS-DSP1
UniProtKB ID: Q8WTR2, B2RA79, Q547H4, Q8WYN4
Gene ID:
Human(142679) Summary: Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. They have been implicated as major modulators of critical signaling pathways. DUSP19 contains a variation of the consensus DUSP C-terminal catalytic domain, with the last serine residue replaced by alanine, and lacks the N-terminal CH2 domain found in the MKP (mitogen-activated protein kinase phosphatase) class of DUSPs (see MIM 600714) (summary by Patterson et al., 2009 [PubMed 19228121]
Mouse(68082) dual specificity phosphatase 19
Rat(311151) dual specificity phosphatase 19
Zebrafish(792815) dual specificity phosphatase 19
cow(505754) dual specificity phosphatase 19
domestic cat(101084560) dual specificity phosphatase 19
dog(488433) dual specificity phosphatase 19
chicken(423999) dual specificity phosphatase 19
sheep(101117733) dual specificity phosphatase 19
naked mole-rat(101715210) dual specificity phosphatase 19
domestic guinea pig(100714989) dual specificity phosphatase 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080876 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080876 Rosetta Predictions human pricing
NM_001107739 Rosetta Predictions rat pricing
NM_024438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081399 predicted 839
2 SASI_Hs02_00362673 predicted 240
3 SASI_Hs01_00081400 predicted 506
4 SASI_Hs01_00081401 predicted 794
5 SASI_Hs01_00081402 predicted 742
6 SASI_Hs01_00081403 predicted 607
7 SASI_Hs01_00081404 predicted 518
8 SASI_Hs01_00081406 predicted 379
9 SASI_Hs01_00081407 predicted 650
10 SASI_Hs01_00081408 predicted 867
11 SASI_Hs01_00081405 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231795 predicted 2383
2 SASI_Rn02_00231796 predicted 2468
3 SASI_Rn02_00231797 predicted 2332
4 SASI_Rn02_00231798 predicted 1961
5 SASI_Rn02_00231799 predicted 2060
6 SASI_Rn02_00231800 predicted 2311
7 SASI_Rn02_00231801 predicted 2473
8 SASI_Rn02_00231802 predicted 2396
9 SASI_Rn02_00231803 predicted 2028
10 SASI_Rn02_00231804 predicted 2248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197520 predicted 951
2 SASI_Mm01_00197521 predicted 635
3 SASI_Mm02_00327766 predicted 947
4 SASI_Mm01_00197522 predicted 457
5 SASI_Mm01_00197524 predicted 1051
6 SASI_Mm01_00197525 predicted 531
7 SASI_Mm01_00197526 predicted 493
8 SASI_Mm01_00197527 predicted 400
9 SASI_Mm01_00197529 predicted 784
10 SASI_Mm02_00327767 predicted 438
11 SASI_Mm01_00197523 predicted 435
12 SASI_Mm01_00197528 predicted 1059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024438
VALIDATED
DUSP19 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 19
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024438.2-1299s1c1
Sequence:CCGGCGCCAAGAGTACCAGAATCAACTCGAGTTGATTCTGGTACTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024438.2-486s1c1
Sequence:CCGGCCTCAGTGAGTTTACATATAACTCGAGTTATATGTAAACTCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024438.2-514s1c1
Sequence:CCGGTCTATACTGGATGTGCCTGAACTCGAGTTCAGGCACATCCAGTATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024438.2-240s1c1
Sequence:CCGGGACCACGCTAACTGGAAAGAACTCGAGTTCTTTCCAGTTAGCGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024438.2-431s1c1
Sequence:CCGGGAAAGCATAAGGTGACTCATACTCGAGTATGAGTCACCTTATGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024438.4-513s21c1
Sequence:CCGGTCTATACTGGATGTGCCTGAACTCGAGTTCAGGCACATCCAGTATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024438.4-485s21c1
Sequence:CCGGCCTCAGTGAGTTTACATATAACTCGAGTTATATGTAAACTCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024438.4-239s21c1
Sequence:CCGGGACCACGCTAACTGGAAAGAACTCGAGTTCTTTCCAGTTAGCGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348576    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024438.4-954s21c1
Sequence:CCGGACCTTTGTCGCCCTGAATTAACTCGAGTTAATTCAGGGCGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024438
VALIDATED
DUSP19 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 19
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024438.2-1299s1c1
Sequence:CCGGCGCCAAGAGTACCAGAATCAACTCGAGTTGATTCTGGTACTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024438.2-486s1c1
Sequence:CCGGCCTCAGTGAGTTTACATATAACTCGAGTTATATGTAAACTCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024438.2-514s1c1
Sequence:CCGGTCTATACTGGATGTGCCTGAACTCGAGTTCAGGCACATCCAGTATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024438.2-240s1c1
Sequence:CCGGGACCACGCTAACTGGAAAGAACTCGAGTTCTTTCCAGTTAGCGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024438.2-431s1c1
Sequence:CCGGGAAAGCATAAGGTGACTCATACTCGAGTATGAGTCACCTTATGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024438.4-513s21c1
Sequence:CCGGTCTATACTGGATGTGCCTGAACTCGAGTTCAGGCACATCCAGTATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024438.4-485s21c1
Sequence:CCGGCCTCAGTGAGTTTACATATAACTCGAGTTATATGTAAACTCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024438.4-239s21c1
Sequence:CCGGGACCACGCTAACTGGAAAGAACTCGAGTTCTTTCCAGTTAGCGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348576    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024438.4-954s21c1
Sequence:CCGGACCTTTGTCGCCCTGAATTAACTCGAGTTAATTCAGGGCGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024438
VALIDATED
DUSP19 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 19
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024438.2-1299s1c1
Sequence:CCGGCGCCAAGAGTACCAGAATCAACTCGAGTTGATTCTGGTACTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024438.2-486s1c1
Sequence:CCGGCCTCAGTGAGTTTACATATAACTCGAGTTATATGTAAACTCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024438.2-514s1c1
Sequence:CCGGTCTATACTGGATGTGCCTGAACTCGAGTTCAGGCACATCCAGTATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024438.2-240s1c1
Sequence:CCGGGACCACGCTAACTGGAAAGAACTCGAGTTCTTTCCAGTTAGCGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024438.2-431s1c1
Sequence:CCGGGAAAGCATAAGGTGACTCATACTCGAGTATGAGTCACCTTATGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024438.4-513s21c1
Sequence:CCGGTCTATACTGGATGTGCCTGAACTCGAGTTCAGGCACATCCAGTATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024438.4-485s21c1
Sequence:CCGGCCTCAGTGAGTTTACATATAACTCGAGTTATATGTAAACTCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024438.4-239s21c1
Sequence:CCGGGACCACGCTAACTGGAAAGAACTCGAGTTCTTTCCAGTTAGCGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348576    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024438.4-954s21c1
Sequence:CCGGACCTTTGTCGCCCTGAATTAACTCGAGTTAATTCAGGGCGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080876
DUSP19 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 19
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080876.x-219s1c1
Sequence:CCGGCGGAATAATCTCAGGAAGCAACTCGAGTTGCTTCCTGAGATTATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080876.x-529s1c1
Sequence:CCGGCTATATTGGATCTGCCTGAAACTCGAGTTTCAGGCAGATCCAATATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080876.x-251s1c1
Sequence:CCGGGACAACGCTAACTGGAAAGAACTCGAGTTCTTTCCAGTTAGCGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080876.x-3368s1c1
Sequence:CCGGGCCTGGATTGTGTATTATTTACTCGAGTAAATAATACACAATCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080876.3-955s21c1
Sequence:CCGGATGGAGCAGCTTCGTACATATCTCGAGATATGTACGAAGCTGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080876.3-1335s21c1
Sequence:CCGGAGCATGGAGAGAATCATTTAACTCGAGTTAAATGATTCTCTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080876.3-1146s21c1
Sequence:CCGGTGCATAAATGGAGGTCAATTTCTCGAGAAATTGACCTCCATTTATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080876.3-563s21c1
Sequence:CCGGACCTGCAAGTTGGCGTTATTACTCGAGTAATAACGCCAACTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080876
DUSP19 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 19
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080876.x-219s1c1
Sequence:CCGGCGGAATAATCTCAGGAAGCAACTCGAGTTGCTTCCTGAGATTATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080876.x-529s1c1
Sequence:CCGGCTATATTGGATCTGCCTGAAACTCGAGTTTCAGGCAGATCCAATATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080876.x-251s1c1
Sequence:CCGGGACAACGCTAACTGGAAAGAACTCGAGTTCTTTCCAGTTAGCGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080876.x-3368s1c1
Sequence:CCGGGCCTGGATTGTGTATTATTTACTCGAGTAAATAATACACAATCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080876.3-955s21c1
Sequence:CCGGATGGAGCAGCTTCGTACATATCTCGAGATATGTACGAAGCTGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080876.3-1335s21c1
Sequence:CCGGAGCATGGAGAGAATCATTTAACTCGAGTTAAATGATTCTCTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080876.3-1146s21c1
Sequence:CCGGTGCATAAATGGAGGTCAATTTCTCGAGAAATTGACCTCCATTTATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080876.3-563s21c1
Sequence:CCGGACCTGCAAGTTGGCGTTATTACTCGAGTAATAACGCCAACTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080876
DUSP19 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 19
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080876.x-219s1c1
Sequence:CCGGCGGAATAATCTCAGGAAGCAACTCGAGTTGCTTCCTGAGATTATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080876.x-529s1c1
Sequence:CCGGCTATATTGGATCTGCCTGAAACTCGAGTTTCAGGCAGATCCAATATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080876.x-251s1c1
Sequence:CCGGGACAACGCTAACTGGAAAGAACTCGAGTTCTTTCCAGTTAGCGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080876.x-3368s1c1
Sequence:CCGGGCCTGGATTGTGTATTATTTACTCGAGTAAATAATACACAATCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080876.3-955s21c1
Sequence:CCGGATGGAGCAGCTTCGTACATATCTCGAGATATGTACGAAGCTGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080876.3-1335s21c1
Sequence:CCGGAGCATGGAGAGAATCATTTAACTCGAGTTAAATGATTCTCTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080876.3-1146s21c1
Sequence:CCGGTGCATAAATGGAGGTCAATTTCTCGAGAAATTGACCTCCATTTATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080876.3-563s21c1
Sequence:CCGGACCTGCAAGTTGGCGTTATTACTCGAGTAATAACGCCAACTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks