EMAIL THIS PAGE TO A FRIEND

DUSP1

dual specificity phosphatase 1

Synonyms: CL100 HVH1 MKP-1 MKP1 PTPN10
UniProtKB ID: P28562, D3DQL9, Q2V508
Gene ID:
Human(1843) Summary: The expression of DUSP1 gene is induced in human skin fibroblasts by oxidative/heat stress and growth factors. It specifies a protein with structural features similar to members of the non-receptor-type protein-tyrosine phosphatase family, and which has significant amino-acid sequence similarity to a Tyr/Ser-protein phosphatase encoded by the late gene H1 of vaccinia virus. The bacterially expressed and purified DUSP1 protein has intrinsic phosphatase activity, and specifically inactivates mitogen-activated protein (MAP) kinase in vitro by the concomitant dephosphorylation of both its phosphothreonine and phosphotyrosine residues. Furthermore, it suppresses the activation of MAP kinase by oncogenic ras in extracts of Xenopus oocytes. Thus, DUSP1 may play an important role in the human cellular response to environmental stress as well as in the negative regulation of cellular proliferation. [provided by RefSeq, Jul 2008]
Mouse(19252) dual specificity phosphatase 1
Rat(114856) dual specificity phosphatase 1
sheep(101107632) dual specificity phosphatase 1
Domestic Rabbit(100340993) dual specificity phosphatase 1
naked mole-rat(101701425) dual specificity phosphatase 1
domestic guinea pig(100725668) dual specificity phosphatase 1
Zebrafish(406340) dual specificity phosphatase 1
chicken(374192) dual specificity phosphatase 1
dog(489117) dual specificity phosphatase 1
cow(539175) dual specificity phosphatase 1
domestic cat(101093416) dual specificity phosphatase 1
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013642 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013642 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013642 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004417 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004417 Rosetta Predictions human pricing
NM_053769 Rosetta Predictions rat pricing
NM_013642 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098747 predicted 838
2 SASI_Hs02_00337565 predicted 1024
3 SASI_Hs01_00098748 predicted 1533
4 SASI_Hs01_00098749 predicted 863
5 SASI_Hs01_00098750 predicted 953
6 SASI_Hs01_00098751 predicted 718
7 SASI_Hs01_00098752 predicted 1490
8 SASI_Hs01_00098753 predicted 1046
9 SASI_Hs01_00098754 predicted 1543
10 SASI_Hs01_00098755 predicted 1121
11 SASI_Hs01_00098756 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053769 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037818 predicted 933
2 SASI_Rn01_00037819 predicted 1589
3 SASI_Rn01_00037820 predicted 731
4 SASI_Rn01_00037822 predicted 1595
5 SASI_Rn01_00037823 predicted 468
6 SASI_Rn02_00266565 predicted 831
7 SASI_Rn01_00037824 predicted 842
8 SASI_Rn01_00037825 predicted 1638
9 SASI_Rn01_00037826 predicted 1136
10 SASI_Rn02_00266566 predicted 994
11 SASI_Rn01_00037821 predicted 1666
12 SASI_Rn01_00037827 predicted 1569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013642 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322441 predicted 833
2 SASI_Mm01_00056586 predicted 844
3 SASI_Mm01_00056587 predicted 849
4 SASI_Mm02_00322442 predicted 248
5 SASI_Mm01_00056588 predicted 609
6 SASI_Mm01_00056589 predicted 650
7 SASI_Mm01_00056590 predicted 695
8 SASI_Mm02_00322443 predicted 486
9 SASI_Mm01_00056591 predicted 752
10 SASI_Mm01_00056592 predicted 608
11 SASI_Mm01_00056585 predicted 932
12 SASI_Mm01_00056593 predicted 935
13 SASI_Mm01_00056594 predicted 1331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013642
DUSP1 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 1
Mouse
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-895s21c1
Sequence:CCGGATGCTGGAGGGAGAGTGTTTGCTCGAGCAAACACTCTCCCTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-490s21c1
Sequence:CCGGGCTCCACTCAAGTCTTCTTTCCTCGAGGAAAGAAGACTTGAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013642.3-1459s21c1
Sequence:CCGGGCACATTCGGGACCAATATATCTCGAGATATATTGGTCCCGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-782s21c1
Sequence:CCGGTAACCACTTTGAGGGTCACTACTCGAGTAGTGACCCTCAAAGTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-969s21c1
Sequence:CCGGATGAGGACTAACCGGGTAAAGCTCGAGCTTTACCCGGTTAGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-758s21c1
Sequence:CCGGGATCAACGTCTCAGCCAATTGCTCGAGCAATTGGCTGAGACGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-234s21c1
Sequence:CCGGTGTCGCTCCTTCTTCGCTTTCCTCGAGGAAAGCGAAGAAGGAGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013642.3-1341s21c1
Sequence:CCGGCATGGGAGCTGGTCCTTATTTCTCGAGAAATAAGGACCAGCTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-712s1c1
Sequence:CCGGGAAGGATATGCTTGACGCCTTCTCGAGAAGGCGTCAAGCATATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-322s1c1
Sequence:CCGGCCTGGAGCATATCGTGCCCAACTCGAGTTGGGCACGATATGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-1192s1c1
Sequence:CCGGCAGTGCCCTGAACTACCTTAACTCGAGTTAAGGTAGTTCAGGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-990s1c1
Sequence:CCGGCCTTTGAGTTTGTGAAGCAGACTCGAGTCTGCTTCACAAACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-853s1c1
Sequence:CCGGCGAGGCTATTGACTTCATAGACTCGAGTCTATGAAGTCAATAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-502s1c1
Sequence:CCGGCCAAGGAGGATATGAAGCGTTCTCGAGAACGCTTCATATCCTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-214s1c1
Sequence:CCGGGTTGTTGGATTGTCGCTCCTTCTCGAGAAGGAGCGACAATCCAACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-842s1c1
Sequence:CCGGTCCTGGTTCAACGAGGCTATTCTCGAGAATAGCCTCGTTGAACCAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-958s1c1
Sequence:CCGGCATGAGGACTAACCGGGTAAACTCGAGTTTACCCGGTTAGTCCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-704s1c1
Sequence:CCGGGCTTCTCGGAAGGATATGCTTCTCGAGAAGCATATCCTTCCGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013642
DUSP1 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 1
Mouse
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-895s21c1
Sequence:CCGGATGCTGGAGGGAGAGTGTTTGCTCGAGCAAACACTCTCCCTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-490s21c1
Sequence:CCGGGCTCCACTCAAGTCTTCTTTCCTCGAGGAAAGAAGACTTGAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013642.3-1459s21c1
Sequence:CCGGGCACATTCGGGACCAATATATCTCGAGATATATTGGTCCCGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-782s21c1
Sequence:CCGGTAACCACTTTGAGGGTCACTACTCGAGTAGTGACCCTCAAAGTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-969s21c1
Sequence:CCGGATGAGGACTAACCGGGTAAAGCTCGAGCTTTACCCGGTTAGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-758s21c1
Sequence:CCGGGATCAACGTCTCAGCCAATTGCTCGAGCAATTGGCTGAGACGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-234s21c1
Sequence:CCGGTGTCGCTCCTTCTTCGCTTTCCTCGAGGAAAGCGAAGAAGGAGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013642.3-1341s21c1
Sequence:CCGGCATGGGAGCTGGTCCTTATTTCTCGAGAAATAAGGACCAGCTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-712s1c1
Sequence:CCGGGAAGGATATGCTTGACGCCTTCTCGAGAAGGCGTCAAGCATATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-322s1c1
Sequence:CCGGCCTGGAGCATATCGTGCCCAACTCGAGTTGGGCACGATATGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-1192s1c1
Sequence:CCGGCAGTGCCCTGAACTACCTTAACTCGAGTTAAGGTAGTTCAGGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-990s1c1
Sequence:CCGGCCTTTGAGTTTGTGAAGCAGACTCGAGTCTGCTTCACAAACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-853s1c1
Sequence:CCGGCGAGGCTATTGACTTCATAGACTCGAGTCTATGAAGTCAATAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-502s1c1
Sequence:CCGGCCAAGGAGGATATGAAGCGTTCTCGAGAACGCTTCATATCCTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-214s1c1
Sequence:CCGGGTTGTTGGATTGTCGCTCCTTCTCGAGAAGGAGCGACAATCCAACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-842s1c1
Sequence:CCGGTCCTGGTTCAACGAGGCTATTCTCGAGAATAGCCTCGTTGAACCAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-958s1c1
Sequence:CCGGCATGAGGACTAACCGGGTAAACTCGAGTTTACCCGGTTAGTCCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-704s1c1
Sequence:CCGGGCTTCTCGGAAGGATATGCTTCTCGAGAAGCATATCCTTCCGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013642
DUSP1 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 1
Mouse
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-895s21c1
Sequence:CCGGATGCTGGAGGGAGAGTGTTTGCTCGAGCAAACACTCTCCCTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-490s21c1
Sequence:CCGGGCTCCACTCAAGTCTTCTTTCCTCGAGGAAAGAAGACTTGAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013642.3-1459s21c1
Sequence:CCGGGCACATTCGGGACCAATATATCTCGAGATATATTGGTCCCGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-782s21c1
Sequence:CCGGTAACCACTTTGAGGGTCACTACTCGAGTAGTGACCCTCAAAGTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-969s21c1
Sequence:CCGGATGAGGACTAACCGGGTAAAGCTCGAGCTTTACCCGGTTAGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-758s21c1
Sequence:CCGGGATCAACGTCTCAGCCAATTGCTCGAGCAATTGGCTGAGACGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013642.3-234s21c1
Sequence:CCGGTGTCGCTCCTTCTTCGCTTTCCTCGAGGAAAGCGAAGAAGGAGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013642.3-1341s21c1
Sequence:CCGGCATGGGAGCTGGTCCTTATTTCTCGAGAAATAAGGACCAGCTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-712s1c1
Sequence:CCGGGAAGGATATGCTTGACGCCTTCTCGAGAAGGCGTCAAGCATATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-322s1c1
Sequence:CCGGCCTGGAGCATATCGTGCCCAACTCGAGTTGGGCACGATATGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-1192s1c1
Sequence:CCGGCAGTGCCCTGAACTACCTTAACTCGAGTTAAGGTAGTTCAGGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-990s1c1
Sequence:CCGGCCTTTGAGTTTGTGAAGCAGACTCGAGTCTGCTTCACAAACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-853s1c1
Sequence:CCGGCGAGGCTATTGACTTCATAGACTCGAGTCTATGAAGTCAATAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-502s1c1
Sequence:CCGGCCAAGGAGGATATGAAGCGTTCTCGAGAACGCTTCATATCCTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-214s1c1
Sequence:CCGGGTTGTTGGATTGTCGCTCCTTCTCGAGAAGGAGCGACAATCCAACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-842s1c1
Sequence:CCGGTCCTGGTTCAACGAGGCTATTCTCGAGAATAGCCTCGTTGAACCAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-958s1c1
Sequence:CCGGCATGAGGACTAACCGGGTAAACTCGAGTTTACCCGGTTAGTCCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013642.1-704s1c1
Sequence:CCGGGCTTCTCGGAAGGATATGCTTCTCGAGAAGCATATCCTTCCGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004417
VALIDATED
DUSP1 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 1
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-334s21c1
Sequence:CCGGGCCGCTCCTTCTTCGCTTTCACTCGAGTGAAAGCGAAGAAGGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-961s21c1
Sequence:CCGGACGAGGCCATTGACTTCATAGCTCGAGCTATGAAGTCAATGGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-608s21c1
Sequence:CCGGCCTCAAAGGAGGATACGAAGCCTCGAGGCTTCGTATCCTCCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-1251s21c1
Sequence:CCGGACCACCACCGTGTTCAACTTCCTCGAGGAAGTTGAACACGGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-1112s21c1
Sequence:CCGGGAAGCAGAGGCGAAGCATCATCTCGAGATGATGCTTCGCCTCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-770s21c1
Sequence:CCGGGGTGGAAATCCTGCCCTTTCTCTCGAGAGAAAGGGCAGGATTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004417.2-1437s21c1
Sequence:CCGGTCGAGAGGGCTGGTCCTTATTCTCGAGAATAAGGACCAGCCCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-1060s21c1
Sequence:CCGGCTTACCTTATGAGGACTAATCCTCGAGGATTAGTCCTCATAAGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-994s21c1
Sequence:CCGGATGCTGGAGGAAGGGTGTTTGCTCGAGCAAACACCCTTCCTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004417.2-891s21c1
Sequence:CCGGGAGGGTCACTACCAGTACAAGCTCGAGCTTGTACTGGTAGTGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-869s21c1
Sequence:CCGGAGCCAATTGTCCCAACCATTTCTCGAGAAATGGTTGGGACAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-829s21c1
Sequence:CCGGTGCTGGATGCCTTGGGCATAACTCGAGTTATGCCCAAGGCATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004417.2-1537s21c1
Sequence:CCGGGCACATTCGGGACCAATATATCTCGAGATATATTGGTCCCGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004417.x-1909s1c1
Sequence:CCGGGCTGATTATTTATGACCTGAACTCGAGTTCAGGTCATAAATAATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004417.x-611s1c1
Sequence:CCGGCAAAGGAGGATACGAAGCGTTCTCGAGAACGCTTCGTATCCTCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004417.x-373s1c1
Sequence:CCGGGCTCTGTCAACGTGCGCTTCACTCGAGTGAAGCGCACGTTGACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004417.x-1105s1c1
Sequence:CCGGAGTTTGTGAAGCAGAGGCGAACTCGAGTTCGCCTCTGCTTCACAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004417.x-332s1c1
Sequence:CCGGCTGCCGCTCCTTCTTCGCTTTCTCGAGAAAGCGAAGAAGGAGCGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004417
VALIDATED
DUSP1 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 1
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-334s21c1
Sequence:CCGGGCCGCTCCTTCTTCGCTTTCACTCGAGTGAAAGCGAAGAAGGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-961s21c1
Sequence:CCGGACGAGGCCATTGACTTCATAGCTCGAGCTATGAAGTCAATGGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-608s21c1
Sequence:CCGGCCTCAAAGGAGGATACGAAGCCTCGAGGCTTCGTATCCTCCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-1251s21c1
Sequence:CCGGACCACCACCGTGTTCAACTTCCTCGAGGAAGTTGAACACGGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-1112s21c1
Sequence:CCGGGAAGCAGAGGCGAAGCATCATCTCGAGATGATGCTTCGCCTCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-770s21c1
Sequence:CCGGGGTGGAAATCCTGCCCTTTCTCTCGAGAGAAAGGGCAGGATTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004417.2-1437s21c1
Sequence:CCGGTCGAGAGGGCTGGTCCTTATTCTCGAGAATAAGGACCAGCCCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-1060s21c1
Sequence:CCGGCTTACCTTATGAGGACTAATCCTCGAGGATTAGTCCTCATAAGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-994s21c1
Sequence:CCGGATGCTGGAGGAAGGGTGTTTGCTCGAGCAAACACCCTTCCTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004417.2-891s21c1
Sequence:CCGGGAGGGTCACTACCAGTACAAGCTCGAGCTTGTACTGGTAGTGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-869s21c1
Sequence:CCGGAGCCAATTGTCCCAACCATTTCTCGAGAAATGGTTGGGACAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-829s21c1
Sequence:CCGGTGCTGGATGCCTTGGGCATAACTCGAGTTATGCCCAAGGCATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004417.2-1537s21c1
Sequence:CCGGGCACATTCGGGACCAATATATCTCGAGATATATTGGTCCCGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004417.x-1909s1c1
Sequence:CCGGGCTGATTATTTATGACCTGAACTCGAGTTCAGGTCATAAATAATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004417.x-611s1c1
Sequence:CCGGCAAAGGAGGATACGAAGCGTTCTCGAGAACGCTTCGTATCCTCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004417.x-373s1c1
Sequence:CCGGGCTCTGTCAACGTGCGCTTCACTCGAGTGAAGCGCACGTTGACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004417.x-1105s1c1
Sequence:CCGGAGTTTGTGAAGCAGAGGCGAACTCGAGTTCGCCTCTGCTTCACAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004417.x-332s1c1
Sequence:CCGGCTGCCGCTCCTTCTTCGCTTTCTCGAGAAAGCGAAGAAGGAGCGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004417
VALIDATED
DUSP1 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 1
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-334s21c1
Sequence:CCGGGCCGCTCCTTCTTCGCTTTCACTCGAGTGAAAGCGAAGAAGGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-961s21c1
Sequence:CCGGACGAGGCCATTGACTTCATAGCTCGAGCTATGAAGTCAATGGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-608s21c1
Sequence:CCGGCCTCAAAGGAGGATACGAAGCCTCGAGGCTTCGTATCCTCCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-1251s21c1
Sequence:CCGGACCACCACCGTGTTCAACTTCCTCGAGGAAGTTGAACACGGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-1112s21c1
Sequence:CCGGGAAGCAGAGGCGAAGCATCATCTCGAGATGATGCTTCGCCTCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-770s21c1
Sequence:CCGGGGTGGAAATCCTGCCCTTTCTCTCGAGAGAAAGGGCAGGATTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004417.2-1437s21c1
Sequence:CCGGTCGAGAGGGCTGGTCCTTATTCTCGAGAATAAGGACCAGCCCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-1060s21c1
Sequence:CCGGCTTACCTTATGAGGACTAATCCTCGAGGATTAGTCCTCATAAGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-994s21c1
Sequence:CCGGATGCTGGAGGAAGGGTGTTTGCTCGAGCAAACACCCTTCCTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004417.2-891s21c1
Sequence:CCGGGAGGGTCACTACCAGTACAAGCTCGAGCTTGTACTGGTAGTGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-869s21c1
Sequence:CCGGAGCCAATTGTCCCAACCATTTCTCGAGAAATGGTTGGGACAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004417.2-829s21c1
Sequence:CCGGTGCTGGATGCCTTGGGCATAACTCGAGTTATGCCCAAGGCATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004417.2-1537s21c1
Sequence:CCGGGCACATTCGGGACCAATATATCTCGAGATATATTGGTCCCGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004417.x-1909s1c1
Sequence:CCGGGCTGATTATTTATGACCTGAACTCGAGTTCAGGTCATAAATAATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004417.x-611s1c1
Sequence:CCGGCAAAGGAGGATACGAAGCGTTCTCGAGAACGCTTCGTATCCTCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004417.x-373s1c1
Sequence:CCGGGCTCTGTCAACGTGCGCTTCACTCGAGTGAAGCGCACGTTGACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004417.x-1105s1c1
Sequence:CCGGAGTTTGTGAAGCAGAGGCGAACTCGAGTTCGCCTCTGCTTCACAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004417.x-332s1c1
Sequence:CCGGCTGCCGCTCCTTCTTCGCTTTCTCGAGAAAGCGAAGAAGGAGCGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks