EMAIL THIS PAGE TO A FRIEND

DUSP21

dual specificity phosphatase 21

53 Gene Product Result for
Synonyms: LMWDSP21
UniProtKB ID: Q9H596, Q0VDA6, Q6IAJ6, Q6YDQ8
Gene ID:
Human(63904) Summary: This gene encodes a member of the dual specificity phosphatase family, specifically the low molecular weight dual specificity phosphatase family. The encoded protein localizes to both the cytoplasm and the nucleus and functions to remove phosphate groups from phosphotyrosine and phosphothreonine residues.[provided by RefSeq, Mar 2009]
Mouse(73547) dual specificity phosphatase 21
Rat(302867) dual specificity phosphatase 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022076 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_135794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_135794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_135794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_028568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU011671 MISSION® esiRNA esiRNA targeting mouse Dusp21 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022076 Rosetta Predictions human pricing
NM_001106971 Rosetta Predictions rat pricing
NM_028568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141398 predicted 569
2 SASI_Hs01_00141399 predicted 287
3 SASI_Hs01_00141400 predicted 588
4 SASI_Hs01_00141402 predicted 343
5 SASI_Hs01_00141403 predicted 260
6 SASI_Hs01_00141404 predicted 397
7 SASI_Hs01_00141405 predicted 346
8 SASI_Hs01_00141407 predicted 255
9 SASI_Hs02_00355445 predicted 573
10 SASI_Hs02_00355446 predicted 476
11 SASI_Hs01_00141401 predicted 204
12 SASI_Hs01_00141406 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224216 predicted 607
2 SASI_Rn02_00224217 predicted 331
3 SASI_Rn02_00224218 predicted 339
4 SASI_Rn02_00224219 predicted 596
5 SASI_Rn02_00224220 predicted 404
6 SASI_Rn02_00224221 predicted 627
7 SASI_Rn02_00224222 predicted 247
8 SASI_Rn02_00224223 predicted 577
9 SASI_Rn02_00224224 predicted 265
10 SASI_Rn02_00224225 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145036 predicted 209
2 SASI_Mm01_00145037 predicted 524
3 SASI_Mm01_00145038 predicted 299
4 SASI_Mm01_00145039 predicted 285
5 SASI_Mm01_00145040 predicted 430
6 SASI_Mm01_00145041 predicted 561
7 SASI_Mm01_00145042 predicted 239
8 SASI_Mm01_00145043 predicted 570
9 SASI_Mm01_00145044 predicted 429
10 SASI_Mm01_00145045 predicted 295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022076
VALIDATED
DUSP21 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 21
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022076.2-737s1c1
Sequence:CCGGTCTTGCACCAAGACTGAACTTCTCGAGAAGTTCAGTCTTGGTGCAAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022076.2-191s1c1
Sequence:CCGGGCTTCTCCCAAATAACCAGAACTCGAGTTCTGGTTATTTGGGAGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022076.2-661s1c1
Sequence:CCGGGACATCTATGAGAAGGACCTACTCGAGTAGGTCCTTCTCATAGATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022076.2-678s1c1
Sequence:CCGGCCTACGTACGATGATATCAATCTCGAGATTGATATCATCGTACGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022076.2-328s1c1
Sequence:CCGGCAGTACATAAAGGTGCCTGTTCTCGAGAACAGGCACCTTTATGTACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231631    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_022076.2-719s21c1
Sequence:CCGGCCTGACATCTGCCATCGATCTCTCGAGAGATCGATGGCAGATGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_022076.2-674s21c1
Sequence:CCGGAGGACCTACGTACGATGATATCTCGAGATATCATCGTACGTAGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.2-400s21c1
Sequence:CCGGCTTATCCACACCATCGATATGCTCGAGCATATCGATGGTGTGGATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.2-317s21c1
Sequence:CCGGTCGAGGGCATTCAGTACATAACTCGAGTTATGTACTGAATGCCCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.2-294s21c1
Sequence:CCGGGGTGGAAGTGGTCAACGTATTCTCGAGAATACGTTGACCACTTCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-577s21c1
Sequence:CCGGTTGGGAACAGCTCATCAATTACTCGAGTAATTGATGAGCTGTTCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-270s21c1
Sequence:CCGGGCATCACCGCCATTGTCAATGCTCGAGCATTGACAATGGCGGTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-635s21c1
Sequence:CCGGATCAACTCGCCGGTAGGTAACCTCGAGGTTACCTACCGGCGAGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-481s21c1
Sequence:CCGGCCTTGCGTACCTCATGAAATACTCGAGTATTTCATGAGGTACGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-186s21c1
Sequence:CCGGTCTACAGCTTCTCCCAAATAACTCGAGTTATTTGGGAGAAGCTGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-675s21c1
Sequence:CCGGAGGACCTACGTATGATGATATCTCGAGATATCATCATACGTAGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-346s21c1
Sequence:CCGGTGTTACCGATGCTCGTGACTCCTCGAGGAGTCACGAGCATCGGTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022076
VALIDATED
DUSP21 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 21
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022076.2-737s1c1
Sequence:CCGGTCTTGCACCAAGACTGAACTTCTCGAGAAGTTCAGTCTTGGTGCAAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022076.2-191s1c1
Sequence:CCGGGCTTCTCCCAAATAACCAGAACTCGAGTTCTGGTTATTTGGGAGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022076.2-661s1c1
Sequence:CCGGGACATCTATGAGAAGGACCTACTCGAGTAGGTCCTTCTCATAGATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022076.2-678s1c1
Sequence:CCGGCCTACGTACGATGATATCAATCTCGAGATTGATATCATCGTACGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022076.2-328s1c1
Sequence:CCGGCAGTACATAAAGGTGCCTGTTCTCGAGAACAGGCACCTTTATGTACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231631    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_022076.2-719s21c1
Sequence:CCGGCCTGACATCTGCCATCGATCTCTCGAGAGATCGATGGCAGATGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_022076.2-674s21c1
Sequence:CCGGAGGACCTACGTACGATGATATCTCGAGATATCATCGTACGTAGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.2-400s21c1
Sequence:CCGGCTTATCCACACCATCGATATGCTCGAGCATATCGATGGTGTGGATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.2-317s21c1
Sequence:CCGGTCGAGGGCATTCAGTACATAACTCGAGTTATGTACTGAATGCCCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.2-294s21c1
Sequence:CCGGGGTGGAAGTGGTCAACGTATTCTCGAGAATACGTTGACCACTTCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-577s21c1
Sequence:CCGGTTGGGAACAGCTCATCAATTACTCGAGTAATTGATGAGCTGTTCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-270s21c1
Sequence:CCGGGCATCACCGCCATTGTCAATGCTCGAGCATTGACAATGGCGGTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-635s21c1
Sequence:CCGGATCAACTCGCCGGTAGGTAACCTCGAGGTTACCTACCGGCGAGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-481s21c1
Sequence:CCGGCCTTGCGTACCTCATGAAATACTCGAGTATTTCATGAGGTACGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-186s21c1
Sequence:CCGGTCTACAGCTTCTCCCAAATAACTCGAGTTATTTGGGAGAAGCTGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-675s21c1
Sequence:CCGGAGGACCTACGTATGATGATATCTCGAGATATCATCATACGTAGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-346s21c1
Sequence:CCGGTGTTACCGATGCTCGTGACTCCTCGAGGAGTCACGAGCATCGGTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022076
VALIDATED
DUSP21 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 21
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022076.2-737s1c1
Sequence:CCGGTCTTGCACCAAGACTGAACTTCTCGAGAAGTTCAGTCTTGGTGCAAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022076.2-191s1c1
Sequence:CCGGGCTTCTCCCAAATAACCAGAACTCGAGTTCTGGTTATTTGGGAGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022076.2-661s1c1
Sequence:CCGGGACATCTATGAGAAGGACCTACTCGAGTAGGTCCTTCTCATAGATGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022076.2-678s1c1
Sequence:CCGGCCTACGTACGATGATATCAATCTCGAGATTGATATCATCGTACGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022076.2-328s1c1
Sequence:CCGGCAGTACATAAAGGTGCCTGTTCTCGAGAACAGGCACCTTTATGTACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231631    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_022076.2-719s21c1
Sequence:CCGGCCTGACATCTGCCATCGATCTCTCGAGAGATCGATGGCAGATGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_022076.2-674s21c1
Sequence:CCGGAGGACCTACGTACGATGATATCTCGAGATATCATCGTACGTAGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.2-400s21c1
Sequence:CCGGCTTATCCACACCATCGATATGCTCGAGCATATCGATGGTGTGGATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.2-317s21c1
Sequence:CCGGTCGAGGGCATTCAGTACATAACTCGAGTTATGTACTGAATGCCCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.2-294s21c1
Sequence:CCGGGGTGGAAGTGGTCAACGTATTCTCGAGAATACGTTGACCACTTCCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-577s21c1
Sequence:CCGGTTGGGAACAGCTCATCAATTACTCGAGTAATTGATGAGCTGTTCCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-270s21c1
Sequence:CCGGGCATCACCGCCATTGTCAATGCTCGAGCATTGACAATGGCGGTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-635s21c1
Sequence:CCGGATCAACTCGCCGGTAGGTAACCTCGAGGTTACCTACCGGCGAGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-481s21c1
Sequence:CCGGCCTTGCGTACCTCATGAAATACTCGAGTATTTCATGAGGTACGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-186s21c1
Sequence:CCGGTCTACAGCTTCTCCCAAATAACTCGAGTTATTTGGGAGAAGCTGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-675s21c1
Sequence:CCGGAGGACCTACGTATGATGATATCTCGAGATATCATCATACGTAGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022076.3-346s21c1
Sequence:CCGGTGTTACCGATGCTCGTGACTCCTCGAGGAGTCACGAGCATCGGTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_135794
DUSP21 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_135794.3-685s1c1
Sequence:CCGGTGGGTCCTACATCAAGATAAACTCGAGTTTATCTTGATGTAGGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135794.3-311s1c1
Sequence:CCGGCGATGCTCCTAATTCTTACCTCTCGAGAGGTAAGAATTAGGAGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135794.3-578s1c1
Sequence:CCGGGAATACCGTTCGCATGATCTACTCGAGTAGATCATGCGAACGGTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135794.3-315s1c1
Sequence:CCGGGCTCCTAATTCTTACCTCTATCTCGAGATAGAGGTAAGAATTAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135794.3-588s1c1
Sequence:CCGGCGCATGATCTACTCTCCTATACTCGAGTATAGGAGAGTAGATCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_135794
DUSP21 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_135794.3-685s1c1
Sequence:CCGGTGGGTCCTACATCAAGATAAACTCGAGTTTATCTTGATGTAGGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135794.3-311s1c1
Sequence:CCGGCGATGCTCCTAATTCTTACCTCTCGAGAGGTAAGAATTAGGAGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135794.3-578s1c1
Sequence:CCGGGAATACCGTTCGCATGATCTACTCGAGTAGATCATGCGAACGGTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135794.3-315s1c1
Sequence:CCGGGCTCCTAATTCTTACCTCTATCTCGAGATAGAGGTAAGAATTAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135794.3-588s1c1
Sequence:CCGGCGCATGATCTACTCTCCTATACTCGAGTATAGGAGAGTAGATCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_135794
DUSP21 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_135794.3-685s1c1
Sequence:CCGGTGGGTCCTACATCAAGATAAACTCGAGTTTATCTTGATGTAGGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135794.3-311s1c1
Sequence:CCGGCGATGCTCCTAATTCTTACCTCTCGAGAGGTAAGAATTAGGAGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135794.3-578s1c1
Sequence:CCGGGAATACCGTTCGCATGATCTACTCGAGTAGATCATGCGAACGGTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135794.3-315s1c1
Sequence:CCGGGCTCCTAATTCTTACCTCTATCTCGAGATAGAGGTAAGAATTAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135794.3-588s1c1
Sequence:CCGGCGCATGATCTACTCTCCTATACTCGAGTATAGGAGAGTAGATCATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028568
DUSP21 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 21
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000449142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028568.1-437s21c1
Sequence:CCGGCTCATGAAATACCACAATATGCTCGAGCATATTGTGGTATTTCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028568.1-353s21c1
Sequence:CCGGCACGGTGTGGAAATGAGAAATCTCGAGATTTCTCATTTCCACACCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028568
DUSP21 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 21
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000449142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028568.1-437s21c1
Sequence:CCGGCTCATGAAATACCACAATATGCTCGAGCATATTGTGGTATTTCATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028568.1-353s21c1
Sequence:CCGGCACGGTGTGGAAATGAGAAATCTCGAGATTTCTCATTTCCACACCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028568
DUSP21 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 21
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000449142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028568.1-437s21c1
Sequence:CCGGCTCATGAAATACCACAATATGCTCGAGCATATTGTGGTATTTCATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028568.1-353s21c1
Sequence:CCGGCACGGTGTGGAAATGAGAAATCTCGAGATTTCTCATTTCCACACCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)