EMAIL THIS PAGE TO A FRIEND

DUSP22

dual specificity phosphatase 22

83 Gene Product Result for
Synonyms: JKAP JSP1 LMWDSP2 MKPX VHX
UniProtKB ID: Q9NRW4, B4DK56, Q59GW2, Q5VWR2, Q96AR1
Gene ID:
Mouse(105352) dual specificity phosphatase 22
Rat(361242) dual specificity phosphatase 22
domestic guinea pig(100719287) dual specificity phosphatase 22
naked mole-rat(101706474) dual specificity phosphatase 22
sheep(101102433) dual specificity phosphatase 22
chicken(420887) dual specificity phosphatase 22
cow(787471) dual specificity phosphatase 22
domestic cat(101089691) dual specificity phosphatase 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020185 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134068 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134068 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134068 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020185 Rosetta Predictions human pricing
NM_001108412 Rosetta Predictions rat pricing
NM_001037955 Rosetta Predictions mouse pricing
NM_134068 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080575 predicted 721
2 SASI_Hs01_00080576 predicted 916
3 SASI_Hs01_00080578 predicted 1108
4 SASI_Hs01_00080579 predicted 1123
5 SASI_Hs01_00080580 predicted 827
6 SASI_Hs01_00080581 predicted 1192
7 SASI_Hs01_00080582 predicted 1137
8 SASI_Hs01_00080583 predicted 723
9 SASI_Hs01_00080584 predicted 972
10 SASI_Hs02_00353103 predicted 1134
11 SASI_Hs01_00080577 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108412 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238409 predicted 798
2 SASI_Rn02_00238410 predicted 246
3 SASI_Rn02_00238411 predicted 756
4 SASI_Rn02_00238412 predicted 921
5 SASI_Rn02_00238413 predicted 755
6 SASI_Rn02_00238414 predicted 199
7 SASI_Rn02_00238415 predicted 801
8 SASI_Rn02_00238416 predicted 909
9 SASI_Rn02_00238417 predicted 401
10 SASI_Rn02_00238418 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037955 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289565 predicted 261
2 SASI_Mm02_00289566 predicted 258
3 SASI_Mm02_00289567 predicted 306
4 SASI_Mm02_00289568 predicted 308
5 SASI_Mm02_00289569 predicted 259
6 SASI_Mm02_00289570 predicted 223
7 SASI_Mm02_00289571 predicted 203
8 SASI_Mm02_00289572 predicted 298
9 SASI_Mm02_00289573 predicted 207
10 SASI_Mm02_00289574 predicted 260
11 SASI_Mm01_00076371 predicted 927
12 SASI_Mm01_00076372 predicted 925
13 SASI_Mm01_00076373 predicted 538
14 SASI_Mm01_00076374 predicted 934
15 SASI_Mm01_00076375 predicted 878
16 SASI_Mm01_00076376 predicted 1052
17 SASI_Mm01_00076377 predicted 1011
18 SASI_Mm01_00076378 predicted 435
19 SASI_Mm01_00076379 predicted 1102
20 SASI_Mm01_00076380 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339252 predicted 265
2 SASI_Mm01_00038633 predicted 265
3 SASI_Mm01_00038635 predicted 306
4 SASI_Mm02_00339253 predicted 315
5 SASI_Mm01_00038636 predicted 270
6 SASI_Mm01_00038637 predicted 226
7 SASI_Mm02_00339254 predicted 205
8 SASI_Mm02_00339255 predicted 301
9 SASI_Mm01_00038639 predicted 211
10 SASI_Mm02_00339256 predicted 259
11 SASI_Mm01_00038632 predicted 432
12 SASI_Mm01_00038634 predicted 455
13 SASI_Mm01_00038638 predicted 350
14 SASI_Mm01_00038640 predicted 318
15 SASI_Mm01_00038641 predicted 463
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020185
VALIDATED
DUSP22 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 22
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020185.3-858s21c1
Sequence:GTACCGGAGCATGAGGTCCATCAGTATCCTCGAGGATACTGATGGACCTCATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020185.3-567s21c1
Sequence:CCGGCTATGTTGGAGGGAGTTAAATCTCGAGATTTAACTCCCTCCAACATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020185.3-727s21c1
Sequence:CCGGGACACTGGTGATCGCATACATCTCGAGATGTATGCGATCACCAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020185.3-1140s21c1
Sequence:CCGGATGTTGAGAACTAAGGATATTCTCGAGAATATCCTTAGTTCTCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020185.3-474s21c1
Sequence:CCGGTGTACATCGGCAACTTCAAAGCTCGAGCTTTGAAGTTGCCGATGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020185.3-505s21c1
Sequence:CCGGCGCGGAACAATTGAGCAAGAACTCGAGTTCTTGCTCAATTGTTCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020185.3-538s21c1
Sequence:GTACCGGTATTCTGTCTGTCCATGATAGCTCGAGCTATCATGGACAGACAGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_020185.3-566s1c1
Sequence:CCGGCCTATGTTGGAGGGAGTTAAACTCGAGTTTAACTCCCTCCAACATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_020185.3-949s1c1
Sequence:CCGGCGCTCCAGGAATTCTGAAGTTCTCGAGAACTTCAGAATTCCTGGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020185.3-727s1c1
Sequence:CCGGGACACTGGTGATCGCATACATCTCGAGATGTATGCGATCACCAGTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020185.3-505s1c1
Sequence:CCGGCGCGGAACAATTGAGCAAGAACTCGAGTTCTTGCTCAATTGTTCCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_020185.3-1080s1c1
Sequence:CCGGCCAGTAGTGATTTGTAAACTTCTCGAGAAGTTTACAAATCACTACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020185
VALIDATED
DUSP22 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 22
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020185.3-858s21c1
Sequence:GTACCGGAGCATGAGGTCCATCAGTATCCTCGAGGATACTGATGGACCTCATGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020185.3-567s21c1
Sequence:CCGGCTATGTTGGAGGGAGTTAAATCTCGAGATTTAACTCCCTCCAACATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020185.3-727s21c1
Sequence:CCGGGACACTGGTGATCGCATACATCTCGAGATGTATGCGATCACCAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020185.3-1140s21c1
Sequence:CCGGATGTTGAGAACTAAGGATATTCTCGAGAATATCCTTAGTTCTCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020185.3-474s21c1
Sequence:CCGGTGTACATCGGCAACTTCAAAGCTCGAGCTTTGAAGTTGCCGATGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020185.3-505s21c1
Sequence:CCGGCGCGGAACAATTGAGCAAGAACTCGAGTTCTTGCTCAATTGTTCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020185.3-538s21c1
Sequence:GTACCGGTATTCTGTCTGTCCATGATAGCTCGAGCTATCATGGACAGACAGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_020185.3-566s1c1
Sequence:CCGGCCTATGTTGGAGGGAGTTAAACTCGAGTTTAACTCCCTCCAACATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_020185.3-949s1c1
Sequence:CCGGCGCTCCAGGAATTCTGAAGTTCTCGAGAACTTCAGAATTCCTGGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020185.3-727s1c1
Sequence:CCGGGACACTGGTGATCGCATACATCTCGAGATGTATGCGATCACCAGTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020185.3-505s1c1
Sequence:CCGGCGCGGAACAATTGAGCAAGAACTCGAGTTCTTGCTCAATTGTTCCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_020185.3-1080s1c1
Sequence:CCGGCCAGTAGTGATTTGTAAACTTCTCGAGAAGTTTACAAATCACTACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020185
VALIDATED
DUSP22 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 22
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020185.3-858s21c1
Sequence:GTACCGGAGCATGAGGTCCATCAGTATCCTCGAGGATACTGATGGACCTCATGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020185.3-567s21c1
Sequence:CCGGCTATGTTGGAGGGAGTTAAATCTCGAGATTTAACTCCCTCCAACATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020185.3-727s21c1
Sequence:CCGGGACACTGGTGATCGCATACATCTCGAGATGTATGCGATCACCAGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020185.3-1140s21c1
Sequence:CCGGATGTTGAGAACTAAGGATATTCTCGAGAATATCCTTAGTTCTCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020185.3-474s21c1
Sequence:CCGGTGTACATCGGCAACTTCAAAGCTCGAGCTTTGAAGTTGCCGATGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020185.3-505s21c1
Sequence:CCGGCGCGGAACAATTGAGCAAGAACTCGAGTTCTTGCTCAATTGTTCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020185.3-538s21c1
Sequence:GTACCGGTATTCTGTCTGTCCATGATAGCTCGAGCTATCATGGACAGACAGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_020185.3-566s1c1
Sequence:CCGGCCTATGTTGGAGGGAGTTAAACTCGAGTTTAACTCCCTCCAACATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_020185.3-949s1c1
Sequence:CCGGCGCTCCAGGAATTCTGAAGTTCTCGAGAACTTCAGAATTCCTGGAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020185.3-727s1c1
Sequence:CCGGGACACTGGTGATCGCATACATCTCGAGATGTATGCGATCACCAGTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020185.3-505s1c1
Sequence:CCGGCGCGGAACAATTGAGCAAGAACTCGAGTTCTTGCTCAATTGTTCCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_020185.3-1080s1c1
Sequence:CCGGCCAGTAGTGATTTGTAAACTTCTCGAGAAGTTTACAAATCACTACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134068
VALIDATED
DUSP22 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 22
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134068.2-112s21c1
Sequence:CCGGAGGAACAAGGTGACACACATTCTCGAGAATGTGTGTCACCTTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134068.2-847s21c1
Sequence:CCGGCCTGTCTGTTTCGTAATAGTACTCGAGTACTATTACGAAACAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134068.2-157s21c1
Sequence:CCGGCCCATGTTGGAGGGAGTTAAACTCGAGTTTAACTCCCTCCAACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134068.2-436s21c1
Sequence:CCGGCAGGAGTTTGAGAAACATGAACTCGAGTTCATGTTTCTCAAACTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134068.1-844s1c1
Sequence:CCGGCCTGTCTGTTTCGTAATAGTACTCGAGTACTATTACGAAACAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134068.1-155s1c1
Sequence:CCGGCCATGTTGGAGGGAGTTAAATCTCGAGATTTAACTCCCTCCAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134068.1-109s1c1
Sequence:CCGGAGGAACAAGGTGACACACATTCTCGAGAATGTGTGTCACCTTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134068.1-433s1c1
Sequence:CCGGCAGGAGTTTGAGAAACATGAACTCGAGTTCATGTTTCTCAAACTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134068.1-154s1c1
Sequence:CCGGCCCATGTTGGAGGGAGTTAAACTCGAGTTTAACTCCCTCCAACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134068
VALIDATED
DUSP22 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 22
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134068.2-112s21c1
Sequence:CCGGAGGAACAAGGTGACACACATTCTCGAGAATGTGTGTCACCTTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134068.2-847s21c1
Sequence:CCGGCCTGTCTGTTTCGTAATAGTACTCGAGTACTATTACGAAACAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134068.2-157s21c1
Sequence:CCGGCCCATGTTGGAGGGAGTTAAACTCGAGTTTAACTCCCTCCAACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134068.2-436s21c1
Sequence:CCGGCAGGAGTTTGAGAAACATGAACTCGAGTTCATGTTTCTCAAACTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134068.1-844s1c1
Sequence:CCGGCCTGTCTGTTTCGTAATAGTACTCGAGTACTATTACGAAACAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134068.1-155s1c1
Sequence:CCGGCCATGTTGGAGGGAGTTAAATCTCGAGATTTAACTCCCTCCAACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134068.1-109s1c1
Sequence:CCGGAGGAACAAGGTGACACACATTCTCGAGAATGTGTGTCACCTTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134068.1-433s1c1
Sequence:CCGGCAGGAGTTTGAGAAACATGAACTCGAGTTCATGTTTCTCAAACTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134068.1-154s1c1
Sequence:CCGGCCCATGTTGGAGGGAGTTAAACTCGAGTTTAACTCCCTCCAACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134068
VALIDATED
DUSP22 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 22
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134068.2-112s21c1
Sequence:CCGGAGGAACAAGGTGACACACATTCTCGAGAATGTGTGTCACCTTGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134068.2-847s21c1
Sequence:CCGGCCTGTCTGTTTCGTAATAGTACTCGAGTACTATTACGAAACAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134068.2-157s21c1
Sequence:CCGGCCCATGTTGGAGGGAGTTAAACTCGAGTTTAACTCCCTCCAACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134068.2-436s21c1
Sequence:CCGGCAGGAGTTTGAGAAACATGAACTCGAGTTCATGTTTCTCAAACTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134068.1-844s1c1
Sequence:CCGGCCTGTCTGTTTCGTAATAGTACTCGAGTACTATTACGAAACAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134068.1-155s1c1
Sequence:CCGGCCATGTTGGAGGGAGTTAAATCTCGAGATTTAACTCCCTCCAACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134068.1-109s1c1
Sequence:CCGGAGGAACAAGGTGACACACATTCTCGAGAATGTGTGTCACCTTGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134068.1-433s1c1
Sequence:CCGGCAGGAGTTTGAGAAACATGAACTCGAGTTCATGTTTCTCAAACTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134068.1-154s1c1
Sequence:CCGGCCCATGTTGGAGGGAGTTAAACTCGAGTTTAACTCCCTCCAACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)