EMAIL THIS PAGE TO A FRIEND

DUSP23

dual specificity phosphatase 23

54 Gene Product Result for
Synonyms: DUSP25 LDP-3 MOSP RP11-190A12.1 VHZ
UniProtKB ID: Q9BVJ7, Q9NX48
Gene ID:
Mouse(68440) dual specificity phosphatase 23
Rat(360881) dual specificity phosphatase 23
chicken(100858873) dual specificity phosphatase 23
domestic cat(101092825) dual specificity phosphatase 23
cow(513978) dual specificity phosphatase 23
dog(488630) dual specificity phosphatase 23
sheep(101115745) dual specificity phosphatase 23
naked mole-rat(101697783) dual specificity phosphatase 23
domestic guinea pig(100727377) dual specificity phosphatase 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017823 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017823 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017823 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_129566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_129566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_129566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017823 Rosetta Predictions human pricing
XM_341156 Rosetta Predictions rat pricing
NM_026725 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104878 predicted 283
2 SASI_Hs01_00104879 predicted 426
3 SASI_Hs01_00104880 predicted 455
4 SASI_Hs01_00104881 predicted 291
5 SASI_Hs01_00104882 predicted 416
6 SASI_Hs01_00104883 predicted 406
7 SASI_Hs01_00104884 predicted 407
8 SASI_Hs01_00104885 predicted 335
9 SASI_Hs01_00104886 predicted 333
10 SASI_Hs01_00104887 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392503 predicted 291
2 SASI_Rn02_00392504 predicted 242
3 SASI_Rn02_00392505 predicted 304
4 SASI_Rn02_00392506 predicted 345
5 SASI_Rn02_00392507 predicted 306
6 SASI_Rn02_00392508 predicted 239
7 SASI_Rn02_00392509 predicted 296
8 SASI_Rn02_00392510 predicted 356
9 SASI_Rn02_00392511 predicted 351
10 SASI_Rn02_00392512 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172615 predicted 294
2 SASI_Mm01_00172616 predicted 301
3 SASI_Mm01_00172617 predicted 440
4 SASI_Mm01_00172618 predicted 537
5 SASI_Mm01_00172619 predicted 263
6 SASI_Mm01_00172620 predicted 518
7 SASI_Mm01_00172621 predicted 513
8 SASI_Mm01_00172622 predicted 307
9 SASI_Mm01_00172623 predicted 395
10 SASI_Mm01_00172624 predicted 476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017823
DUSP23 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 23
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051763    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_017823.2-652s1c1
Sequence:CCGGCTTGTACTGCTTTGTTGAATACTCGAGTATTCAACAAAGCAGTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017823.2-401s1c1
Sequence:CCGGGCTGAAATCCGACGACTACGACTCGAGTCGTAGTCGTCGGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017823.2-348s1c1
Sequence:CCGGTGCTGGCCTGTTACCTGGTGACTCGAGTCACCAGGTAACAGGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051767    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_017823.2-402s1c1
Sequence:CCGGCTGAAATCCGACGACTACGACCTCGAGGTCGTAGTCGTCGGATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017823.2-346s1c1
Sequence:CCGGCATGCTGGCCTGTTACCTGGTCTCGAGACCAGGTAACAGGCCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017823.3-391s21c1
Sequence:CCGGATTGCTGAAATCCGACGACTACTCGAGTAGTCGTCGGATTTCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017823.3-544s21c1
Sequence:CCGGGATGAAGGGAAGTGGACTAAACTCGAGTTTAGTCCACTTCCCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017823.3-436s21c1
Sequence:CCGGGAGCAGGAGAAAGCAGTCTTCCTCGAGGAAGACTGCTTTCTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017823.3-460s21c1
Sequence:CCGGTTCTACCAGCGAACGAAATAACTCGAGTTATTTCGTTCGCTGGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017823
DUSP23 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 23
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051763    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_017823.2-652s1c1
Sequence:CCGGCTTGTACTGCTTTGTTGAATACTCGAGTATTCAACAAAGCAGTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017823.2-401s1c1
Sequence:CCGGGCTGAAATCCGACGACTACGACTCGAGTCGTAGTCGTCGGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017823.2-348s1c1
Sequence:CCGGTGCTGGCCTGTTACCTGGTGACTCGAGTCACCAGGTAACAGGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051767    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_017823.2-402s1c1
Sequence:CCGGCTGAAATCCGACGACTACGACCTCGAGGTCGTAGTCGTCGGATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017823.2-346s1c1
Sequence:CCGGCATGCTGGCCTGTTACCTGGTCTCGAGACCAGGTAACAGGCCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017823.3-391s21c1
Sequence:CCGGATTGCTGAAATCCGACGACTACTCGAGTAGTCGTCGGATTTCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017823.3-544s21c1
Sequence:CCGGGATGAAGGGAAGTGGACTAAACTCGAGTTTAGTCCACTTCCCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017823.3-436s21c1
Sequence:CCGGGAGCAGGAGAAAGCAGTCTTCCTCGAGGAAGACTGCTTTCTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017823.3-460s21c1
Sequence:CCGGTTCTACCAGCGAACGAAATAACTCGAGTTATTTCGTTCGCTGGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017823
DUSP23 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 23
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051763    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_017823.2-652s1c1
Sequence:CCGGCTTGTACTGCTTTGTTGAATACTCGAGTATTCAACAAAGCAGTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017823.2-401s1c1
Sequence:CCGGGCTGAAATCCGACGACTACGACTCGAGTCGTAGTCGTCGGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017823.2-348s1c1
Sequence:CCGGTGCTGGCCTGTTACCTGGTGACTCGAGTCACCAGGTAACAGGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051767    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_017823.2-402s1c1
Sequence:CCGGCTGAAATCCGACGACTACGACCTCGAGGTCGTAGTCGTCGGATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017823.2-346s1c1
Sequence:CCGGCATGCTGGCCTGTTACCTGGTCTCGAGACCAGGTAACAGGCCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017823.3-391s21c1
Sequence:CCGGATTGCTGAAATCCGACGACTACTCGAGTAGTCGTCGGATTTCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017823.3-544s21c1
Sequence:CCGGGATGAAGGGAAGTGGACTAAACTCGAGTTTAGTCCACTTCCCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017823.3-436s21c1
Sequence:CCGGGAGCAGGAGAAAGCAGTCTTCCTCGAGGAAGACTGCTTTCTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017823.3-460s21c1
Sequence:CCGGTTCTACCAGCGAACGAAATAACTCGAGTTATTTCGTTCGCTGGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_129566
DUSP23 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 23
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129566.2-337s1c1
Sequence:CCGGCGACCAATTTGTGAAGATCGTCTCGAGACGATCTTCACAAATTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129566.2-326s1c1
Sequence:CCGGCCGGAACAGATCGACCAATTTCTCGAGAAATTGGTCGATCTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129566.2-503s1c1
Sequence:CCGGCCAGGATCCATTGAGACGTATCTCGAGATACGTCTCAATGGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129566.2-544s1c1
Sequence:CCGGCCAGTTCTACCAGCGAACAAACTCGAGTTTGTTCGCTGGTAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_129566.2-957s1c1
Sequence:CCGGCCTGAGGATGATGGGATTCTACTCGAGTAGAATCCCATCATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_129566
DUSP23 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 23
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129566.2-337s1c1
Sequence:CCGGCGACCAATTTGTGAAGATCGTCTCGAGACGATCTTCACAAATTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129566.2-326s1c1
Sequence:CCGGCCGGAACAGATCGACCAATTTCTCGAGAAATTGGTCGATCTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129566.2-503s1c1
Sequence:CCGGCCAGGATCCATTGAGACGTATCTCGAGATACGTCTCAATGGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129566.2-544s1c1
Sequence:CCGGCCAGTTCTACCAGCGAACAAACTCGAGTTTGTTCGCTGGTAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_129566.2-957s1c1
Sequence:CCGGCCTGAGGATGATGGGATTCTACTCGAGTAGAATCCCATCATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_129566
DUSP23 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 23
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129566.2-337s1c1
Sequence:CCGGCGACCAATTTGTGAAGATCGTCTCGAGACGATCTTCACAAATTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129566.2-326s1c1
Sequence:CCGGCCGGAACAGATCGACCAATTTCTCGAGAAATTGGTCGATCTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129566.2-503s1c1
Sequence:CCGGCCAGGATCCATTGAGACGTATCTCGAGATACGTCTCAATGGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129566.2-544s1c1
Sequence:CCGGCCAGTTCTACCAGCGAACAAACTCGAGTTTGTTCGCTGGTAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_129566.2-957s1c1
Sequence:CCGGCCTGAGGATGATGGGATTCTACTCGAGTAGAATCCCATCATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks