EMAIL THIS PAGE TO A FRIEND

DUSP26

dual specificity phosphatase 26 (putative)

56 Gene Product Result for
Synonyms: DUSP24 LDP-4 MKP8 NATA1 SKRP3
UniProtKB ID: Q9BV47, D3DSV8, Q9BTW0
Gene ID:
Mouse(66959) dual specificity phosphatase 26 (putative)
Rat(306527) dual specificity phosphatase 26 (putative)
domestic guinea pig(100722007) dual specificity phosphatase 26 (putative)
naked mole-rat(101718484) dual specificity phosphatase 26 (putative)
sheep(101108886) dual specificity phosphatase 26 (putative)
chicken(426921) dual specificity phosphatase 26 (putative)
cow(533896) dual specificity phosphatase 26 (putative)
domestic cat(101090348) dual specificity phosphatase 26 (putative)
dog(608368) dual specificity phosphatase 26 (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024025 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020931 MISSION® esiRNA esiRNA human DUSP26 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024025 Rosetta Predictions human pricing
NM_001012352 Rosetta Predictions rat pricing
NM_025869 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195966 predicted 1370
2 SASI_Hs01_00195967 predicted 576
3 SASI_Hs01_00195968 predicted 1210
4 SASI_Hs01_00195969 predicted 1411
5 SASI_Hs01_00195970 predicted 842
6 SASI_Hs01_00195971 predicted 1204
7 SASI_Hs01_00195972 predicted 391
8 SASI_Hs01_00195973 predicted 1342
9 SASI_Hs01_00195974 predicted 585
10 SASI_Hs01_00195975 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106651 predicted 759
2 SASI_Rn01_00106652 predicted 727
3 SASI_Rn01_00106653 predicted 1194
4 SASI_Rn01_00106654 predicted 1356
5 SASI_Rn01_00106656 predicted 570
6 SASI_Rn01_00106657 predicted 485
7 SASI_Rn01_00106658 predicted 1030
8 SASI_Rn01_00106659 predicted 531
9 SASI_Rn01_00106660 predicted 454
10 SASI_Rn02_00200533 predicted 613
11 SASI_Rn01_00106655 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329186 predicted 1064
2 SASI_Mm02_00329187 predicted 648
3 SASI_Mm02_00329188 predicted 662
4 SASI_Mm02_00329189 predicted 1150
5 SASI_Mm02_00329190 predicted 942
6 SASI_Mm02_00329191 predicted 579
7 SASI_Mm02_00329192 predicted 924
8 SASI_Mm02_00329193 predicted 908
9 SASI_Mm02_00329194 predicted 1170
10 SASI_Mm02_00329195 predicted 601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024025
DUSP26 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 26 (putative)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-767s21c1
Sequence:CCGGGAGGGAAGATCCTGGTGCATTCTCGAGAATGCACCAGGATCTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-551s21c1
Sequence:CCGGACCAGGACATGGCTAACAACCCTCGAGGGTTGTTAGCCATGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-397s21c1
Sequence:CCGGTCAAGGTCTCCTGTTCGAACTCTCGAGAGTTCGAACAGGAGACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-879s21c1
Sequence:CCGGCAAAGACCACCGAGGCATCATCTCGAGATGATGCCTCGGTGGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024025.1-1366s21c1
Sequence:CCGGGGGATACGGCAAGCATGAATGCTCGAGCATTCATGCTTGCCGTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-835s21c1
Sequence:CCGGATGCTGTACCACCACCTTACCCTCGAGGGTAAGGTGGTGGTACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-439s21c1
Sequence:CCGGCCAACCGTTCAACATCCTTTCCTCGAGGAAAGGATGTTGAACGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-497s21c1
Sequence:CCGGGCAAGACAGCCTGTAACCATGCTCGAGCATGGTTACAGGCTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024025.1-1286s21c1
Sequence:CCGGCTCTTTGTGCCCAAGTGTTTCCTCGAGGAAACACTTGGGCACAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-692s21c1
Sequence:CCGGACTCGCCAGCCTTTGACATGACTCGAGTCATGTCAAAGGCTGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024025.x-453s1c1
Sequence:CCGGTCCTTTCCTCAATGTCTTCGACTCGAGTCGAAGACATTGAGGAAAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024025.x-1429s1c1
Sequence:CCGGCAGCGAAGAGATGGTGTGAAACTCGAGTTTCACACCATCTCTTCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024025.x-879s1c1
Sequence:CCGGCAAAGACCACCGAGGCATCATCTCGAGATGATGCCTCGGTGGTCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024025.x-695s1c1
Sequence:CCGGCGCCAGCCTTTGACATGAGCACTCGAGTGCTCATGTCAAAGGCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024025.x-602s1c1
Sequence:CCGGACGTCCTCAATGCCTCACACACTCGAGTGTGTGAGGCATTGAGGACGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024025
DUSP26 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 26 (putative)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-767s21c1
Sequence:CCGGGAGGGAAGATCCTGGTGCATTCTCGAGAATGCACCAGGATCTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-551s21c1
Sequence:CCGGACCAGGACATGGCTAACAACCCTCGAGGGTTGTTAGCCATGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-397s21c1
Sequence:CCGGTCAAGGTCTCCTGTTCGAACTCTCGAGAGTTCGAACAGGAGACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-879s21c1
Sequence:CCGGCAAAGACCACCGAGGCATCATCTCGAGATGATGCCTCGGTGGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024025.1-1366s21c1
Sequence:CCGGGGGATACGGCAAGCATGAATGCTCGAGCATTCATGCTTGCCGTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-835s21c1
Sequence:CCGGATGCTGTACCACCACCTTACCCTCGAGGGTAAGGTGGTGGTACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-439s21c1
Sequence:CCGGCCAACCGTTCAACATCCTTTCCTCGAGGAAAGGATGTTGAACGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-497s21c1
Sequence:CCGGGCAAGACAGCCTGTAACCATGCTCGAGCATGGTTACAGGCTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024025.1-1286s21c1
Sequence:CCGGCTCTTTGTGCCCAAGTGTTTCCTCGAGGAAACACTTGGGCACAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-692s21c1
Sequence:CCGGACTCGCCAGCCTTTGACATGACTCGAGTCATGTCAAAGGCTGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024025.x-453s1c1
Sequence:CCGGTCCTTTCCTCAATGTCTTCGACTCGAGTCGAAGACATTGAGGAAAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024025.x-1429s1c1
Sequence:CCGGCAGCGAAGAGATGGTGTGAAACTCGAGTTTCACACCATCTCTTCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024025.x-879s1c1
Sequence:CCGGCAAAGACCACCGAGGCATCATCTCGAGATGATGCCTCGGTGGTCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024025.x-695s1c1
Sequence:CCGGCGCCAGCCTTTGACATGAGCACTCGAGTGCTCATGTCAAAGGCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024025.x-602s1c1
Sequence:CCGGACGTCCTCAATGCCTCACACACTCGAGTGTGTGAGGCATTGAGGACGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024025
DUSP26 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 26 (putative)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-767s21c1
Sequence:CCGGGAGGGAAGATCCTGGTGCATTCTCGAGAATGCACCAGGATCTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-551s21c1
Sequence:CCGGACCAGGACATGGCTAACAACCCTCGAGGGTTGTTAGCCATGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-397s21c1
Sequence:CCGGTCAAGGTCTCCTGTTCGAACTCTCGAGAGTTCGAACAGGAGACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-879s21c1
Sequence:CCGGCAAAGACCACCGAGGCATCATCTCGAGATGATGCCTCGGTGGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024025.1-1366s21c1
Sequence:CCGGGGGATACGGCAAGCATGAATGCTCGAGCATTCATGCTTGCCGTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-835s21c1
Sequence:CCGGATGCTGTACCACCACCTTACCCTCGAGGGTAAGGTGGTGGTACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-439s21c1
Sequence:CCGGCCAACCGTTCAACATCCTTTCCTCGAGGAAAGGATGTTGAACGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-497s21c1
Sequence:CCGGGCAAGACAGCCTGTAACCATGCTCGAGCATGGTTACAGGCTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024025.1-1286s21c1
Sequence:CCGGCTCTTTGTGCCCAAGTGTTTCCTCGAGGAAACACTTGGGCACAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024025.1-692s21c1
Sequence:CCGGACTCGCCAGCCTTTGACATGACTCGAGTCATGTCAAAGGCTGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024025.x-453s1c1
Sequence:CCGGTCCTTTCCTCAATGTCTTCGACTCGAGTCGAAGACATTGAGGAAAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024025.x-1429s1c1
Sequence:CCGGCAGCGAAGAGATGGTGTGAAACTCGAGTTTCACACCATCTCTTCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024025.x-879s1c1
Sequence:CCGGCAAAGACCACCGAGGCATCATCTCGAGATGATGCCTCGGTGGTCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024025.x-695s1c1
Sequence:CCGGCGCCAGCCTTTGACATGAGCACTCGAGTGCTCATGTCAAAGGCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024025.x-602s1c1
Sequence:CCGGACGTCCTCAATGCCTCACACACTCGAGTGTGTGAGGCATTGAGGACGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025869
DUSP26 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 26 (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025869.1-1151s1c1
Sequence:CCGGCCCAAGTGACAGGTAGTAGAACTCGAGTTCTACTACCTGTCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025869.1-951s1c1
Sequence:CCGGCCTCATGCTGTATCACCACTTCTCGAGAAGTGGTGATACAGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025869.1-723s1c1
Sequence:CCGGCGTGCTCAACGCCTCACACAACTCGAGTTGTGTGAGGCGTTGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025869.1-625s1c1
Sequence:CCGGGCCTGTAACCATGCTGACGAACTCGAGTTCGTCAGCATGGTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025869.1-581s1c1
Sequence:CCGGTCAACGTCTTTGAGTTGGAAACTCGAGTTTCCAACTCAAAGACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025869
DUSP26 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 26 (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025869.1-1151s1c1
Sequence:CCGGCCCAAGTGACAGGTAGTAGAACTCGAGTTCTACTACCTGTCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025869.1-951s1c1
Sequence:CCGGCCTCATGCTGTATCACCACTTCTCGAGAAGTGGTGATACAGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025869.1-723s1c1
Sequence:CCGGCGTGCTCAACGCCTCACACAACTCGAGTTGTGTGAGGCGTTGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025869.1-625s1c1
Sequence:CCGGGCCTGTAACCATGCTGACGAACTCGAGTTCGTCAGCATGGTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025869.1-581s1c1
Sequence:CCGGTCAACGTCTTTGAGTTGGAAACTCGAGTTTCCAACTCAAAGACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025869
DUSP26 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 26 (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025869.1-1151s1c1
Sequence:CCGGCCCAAGTGACAGGTAGTAGAACTCGAGTTCTACTACCTGTCACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025869.1-951s1c1
Sequence:CCGGCCTCATGCTGTATCACCACTTCTCGAGAAGTGGTGATACAGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025869.1-723s1c1
Sequence:CCGGCGTGCTCAACGCCTCACACAACTCGAGTTGTGTGAGGCGTTGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025869.1-625s1c1
Sequence:CCGGGCCTGTAACCATGCTGACGAACTCGAGTTCGTCAGCATGGTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025869.1-581s1c1
Sequence:CCGGTCAACGTCTTTGAGTTGGAAACTCGAGTTTCCAACTCAAAGACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks