EMAIL THIS PAGE TO A FRIEND

DUSP27

dual specificity phosphatase 27 (putative)

86 Gene Product Result for
UniProtKB ID: Q5VZP5, A0AUM4, Q9C074
Gene ID:
Mouse(240892) dual specificity phosphatase 27 (putative)
Rat(498267) dual specificity phosphatase 27 (putative)
chicken(418444) dual specificity phosphatase 27 (putative)
cow(100124500) dual specificity phosphatase 27 (putative)
Horse(100056694) dual specificity phosphatase 27 (putative)
domestic cat(101080350) dual specificity phosphatase 27 (putative)
dog(490361) dual specificity phosphatase 27 (putative)
sheep(101110992) dual specificity phosphatase 27 (putative)
Domestic Rabbit(100352854) dual specificity phosphatase 27 (putative)
naked mole-rat(101721806) dual specificity phosphatase 27 (putative)
domestic guinea pig(100719779) dual specificity phosphatase 27 (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_043739 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_043739 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_043739 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_136364 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_136364 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_136364 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080426 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU149611 MISSION® esiRNA esiRNA targeting mouse Dusp27 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080426 Rosetta Predictions human pricing
XM_043739 Rosetta Predictions human pricing
XM_935434 Rosetta Predictions human pricing
XM_935435 Rosetta Predictions human pricing
XM_001071732 Rosetta Predictions rat pricing
XM_573493 Rosetta Predictions rat pricing
NM_001033344 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314736 predicted 310
2 SASI_Hs02_00314737 predicted 742
3 SASI_Hs02_00314738 predicted 2689
4 SASI_Hs02_00314739 predicted 598
5 SASI_Hs02_00314740 predicted 2681
6 SASI_Hs02_00314741 predicted 2936
7 SASI_Hs02_00314742 predicted 2755
8 SASI_Hs02_00314743 predicted 2140
9 SASI_Hs02_00314744 predicted 474
10 SASI_Hs02_00314745 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_043739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265071 predicted 317
2 SASI_Hs01_00265072 predicted 1655
3 SASI_Hs01_00265073 predicted 749
4 SASI_Hs01_00265074 predicted 2689
5 SASI_Hs01_00265075 predicted 598
6 SASI_Hs01_00265076 predicted 2687
7 SASI_Hs01_00265077 predicted 2946
8 SASI_Hs01_00265078 predicted 2761
9 SASI_Hs01_00265079 predicted 2147
10 SASI_Hs01_00265080 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254652 predicted 705
2 SASI_Hs01_00254653 predicted 688
3 SASI_Hs01_00254654 predicted 1271
4 SASI_Hs01_00254655 predicted 741
5 SASI_Hs01_00254656 predicted 1273
6 SASI_Hs01_00254657 predicted 1243
7 SASI_Hs01_00254658 predicted 1271
8 SASI_Hs01_00254659 predicted 801
9 SASI_Hs01_00254660 predicted 753
10 SASI_Hs01_00254661 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252819 predicted 284
2 SASI_Hs01_00252820 predicted 818
3 SASI_Hs01_00252821 predicted 468
4 SASI_Hs01_00252822 predicted 412
5 SASI_Hs01_00252823 predicted 797
6 SASI_Hs01_00252824 predicted 852
7 SASI_Hs01_00252825 predicted 690
8 SASI_Hs01_00252826 predicted 1392
9 SASI_Hs01_00252827 predicted 275
10 SASI_Hs01_00252828 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071732 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336227 predicted 3556
2 SASI_Rn02_00336228 predicted 3471
3 SASI_Rn02_00336229 predicted 2224
4 SASI_Rn02_00336230 predicted 3269
5 SASI_Rn02_00336231 predicted 1204
6 SASI_Rn02_00336232 predicted 3004
7 SASI_Rn02_00336233 predicted 3228
8 SASI_Rn02_00336234 predicted 597
9 SASI_Rn02_00336235 predicted 3281
10 SASI_Rn02_00336236 predicted 3179
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400374 predicted 3563
2 SASI_Rn02_00400375 predicted 3466
3 SASI_Rn02_00400376 predicted 2220
4 SASI_Rn02_00400377 predicted 3272
5 SASI_Rn02_00400378 predicted 1751
6 SASI_Rn02_00400379 predicted 3012
7 SASI_Rn02_00400380 predicted 2857
8 SASI_Rn02_00400381 predicted 3228
9 SASI_Rn02_00400382 predicted 2223
10 SASI_Rn02_00400383 predicted 3286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051469 predicted 3126
2 SASI_Mm01_00051470 predicted 1764
3 SASI_Mm01_00051471 predicted 2920
4 SASI_Mm01_00051473 predicted 3273
5 SASI_Mm02_00288607 predicted 2794
6 SASI_Mm01_00051474 predicted 2224
7 SASI_Mm01_00051475 predicted 2707
8 SASI_Mm01_00051476 predicted 3071
9 SASI_Mm01_00051477 predicted 3292
10 SASI_Mm01_00051478 predicted 309
11 SASI_Mm01_00051472 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_043739
DUSP27 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 27 (putative)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043739.6-2922s1c1
Sequence:CCGGCCGATATTCTTCCCGCAGTAACTCGAGTTACTGCGGGAAGAATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043739.6-301s1c1
Sequence:CCGGGCAGCCAAACAGATCATCAATCTCGAGATTGATGATCTGTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043739.6-697s1c1
Sequence:CCGGGACTTTCCTGAGGTGGACATTCTCGAGAATGTCCACCTCAGGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043739.6-3468s1c1
Sequence:CCGGCTTCTCTGAATTTGGAGCCAACTCGAGTTGGCTCCAAATTCAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043739.6-1881s1c1
Sequence:CCGGCAAGAGAATCCAATTTGGATTCTCGAGAATCCAAATTGGATTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_043739
DUSP27 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 27 (putative)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043739.6-2922s1c1
Sequence:CCGGCCGATATTCTTCCCGCAGTAACTCGAGTTACTGCGGGAAGAATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043739.6-301s1c1
Sequence:CCGGGCAGCCAAACAGATCATCAATCTCGAGATTGATGATCTGTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043739.6-697s1c1
Sequence:CCGGGACTTTCCTGAGGTGGACATTCTCGAGAATGTCCACCTCAGGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043739.6-3468s1c1
Sequence:CCGGCTTCTCTGAATTTGGAGCCAACTCGAGTTGGCTCCAAATTCAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043739.6-1881s1c1
Sequence:CCGGCAAGAGAATCCAATTTGGATTCTCGAGAATCCAAATTGGATTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_043739
DUSP27 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 27 (putative)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043739.6-2922s1c1
Sequence:CCGGCCGATATTCTTCCCGCAGTAACTCGAGTTACTGCGGGAAGAATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043739.6-301s1c1
Sequence:CCGGGCAGCCAAACAGATCATCAATCTCGAGATTGATGATCTGTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043739.6-697s1c1
Sequence:CCGGGACTTTCCTGAGGTGGACATTCTCGAGAATGTCCACCTCAGGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043739.6-3468s1c1
Sequence:CCGGCTTCTCTGAATTTGGAGCCAACTCGAGTTGGCTCCAAATTCAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_043739.6-1881s1c1
Sequence:CCGGCAAGAGAATCCAATTTGGATTCTCGAGAATCCAAATTGGATTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_136364
DUSP27 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 27 (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136364.6-2877s1c1
Sequence:CCGGGCATGGGTAACGAGATGGATACTCGAGTATCCATCTCGTTACCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_136364.6-3898s1c1
Sequence:CCGGCCACTGAGAAAGACCTGACTTCTCGAGAAGTCAGGTCTTTCTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136364.6-2270s1c1
Sequence:CCGGGCCAGTATCCAGAACTGGATTCTCGAGAATCCAGTTCTGGATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136364.6-3002s1c1
Sequence:CCGGCTCCGGGAAACAGAGTCTAAACTCGAGTTTAGACTCTGTTTCCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136364.6-663s1c1
Sequence:CCGGGCACAGGAGTTTACACTGGTTCTCGAGAACCAGTGTAAACTCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_136364
DUSP27 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 27 (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136364.6-2877s1c1
Sequence:CCGGGCATGGGTAACGAGATGGATACTCGAGTATCCATCTCGTTACCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_136364.6-3898s1c1
Sequence:CCGGCCACTGAGAAAGACCTGACTTCTCGAGAAGTCAGGTCTTTCTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136364.6-2270s1c1
Sequence:CCGGGCCAGTATCCAGAACTGGATTCTCGAGAATCCAGTTCTGGATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136364.6-3002s1c1
Sequence:CCGGCTCCGGGAAACAGAGTCTAAACTCGAGTTTAGACTCTGTTTCCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136364.6-663s1c1
Sequence:CCGGGCACAGGAGTTTACACTGGTTCTCGAGAACCAGTGTAAACTCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_136364
DUSP27 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 27 (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136364.6-2877s1c1
Sequence:CCGGGCATGGGTAACGAGATGGATACTCGAGTATCCATCTCGTTACCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_136364.6-3898s1c1
Sequence:CCGGCCACTGAGAAAGACCTGACTTCTCGAGAAGTCAGGTCTTTCTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136364.6-2270s1c1
Sequence:CCGGGCCAGTATCCAGAACTGGATTCTCGAGAATCCAGTTCTGGATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136364.6-3002s1c1
Sequence:CCGGCTCCGGGAAACAGAGTCTAAACTCGAGTTTAGACTCTGTTTCCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136364.6-663s1c1
Sequence:CCGGGCACAGGAGTTTACACTGGTTCTCGAGAACCAGTGTAAACTCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080426
DUSP27 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 27 (putative)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080426.1-2676s21c1
Sequence:CCGGCATAGGGAGCTTCCGATATTCCTCGAGGAATATCGGAAGCTCCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080426.1-313s21c1
Sequence:CCGGGATGACACCAGCCTCTATAATCTCGAGATTATAGAGGCTGGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080426.1-3164s21c1
Sequence:CCGGCAGAACCACAGCGCCCAAATTCTCGAGAATTTGGGCGCTGTGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080426.1-3693s21c1
Sequence:CCGGGCGGACCAACTGATACCATTTCTCGAGAAATGGTATCAGTTGGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080426
DUSP27 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 27 (putative)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080426.1-2676s21c1
Sequence:CCGGCATAGGGAGCTTCCGATATTCCTCGAGGAATATCGGAAGCTCCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080426.1-313s21c1
Sequence:CCGGGATGACACCAGCCTCTATAATCTCGAGATTATAGAGGCTGGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080426.1-3164s21c1
Sequence:CCGGCAGAACCACAGCGCCCAAATTCTCGAGAATTTGGGCGCTGTGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080426.1-3693s21c1
Sequence:CCGGGCGGACCAACTGATACCATTTCTCGAGAAATGGTATCAGTTGGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080426
DUSP27 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 27 (putative)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080426.1-2676s21c1
Sequence:CCGGCATAGGGAGCTTCCGATATTCCTCGAGGAATATCGGAAGCTCCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080426.1-313s21c1
Sequence:CCGGGATGACACCAGCCTCTATAATCTCGAGATTATAGAGGCTGGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080426.1-3164s21c1
Sequence:CCGGCAGAACCACAGCGCCCAAATTCTCGAGAATTTGGGCGCTGTGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080426.1-3693s21c1
Sequence:CCGGGCGGACCAACTGATACCATTTCTCGAGAAATGGTATCAGTTGGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks