EMAIL THIS PAGE TO A FRIEND

DUSP28

dual specificity phosphatase 28

Synonyms: DUSP26 VHP
UniProtKB ID: Q4G0W2
Gene ID:
Mouse(67446) dual specificity phosphatase 28
Rat(684024) dual specificity phosphatase 28
domestic guinea pig(100733620) dual specificity phosphatase 28
naked mole-rat(101703017) dual specificity phosphatase 28
chicken(430912) dual specificity phosphatase 28
cow(787244) dual specificity phosphatase 28
dog(100688246) dual specificity phosphatase 28
154 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033575 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175118 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175118 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175118 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033575 Rosetta Predictions human pricing
XM_001068576 Rosetta Predictions rat pricing
NM_175118 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049145 predicted 1221
2 SASI_Hs02_00308062 predicted 1068
3 SASI_Hs02_00308063 predicted 1071
4 SASI_Hs01_00049148 predicted 1254
5 SASI_Hs01_00049149 predicted 1184
6 SASI_Hs01_00049150 predicted 1182
7 SASI_Hs01_00049151 predicted 1250
8 SASI_Hs01_00049152 predicted 1255
9 SASI_Hs02_00308064 predicted 1128
10 SASI_Hs01_00049153 predicted 1236
11 SASI_Hs01_00049146 predicted 1238
12 SASI_Hs01_00049147 predicted 1339
13 SASI_Hs01_00049154 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325040 predicted 406
2 SASI_Rn02_00325041 predicted 465
3 SASI_Rn02_00325042 predicted 622
4 SASI_Rn02_00325043 predicted 470
5 SASI_Rn02_00325044 predicted 522
6 SASI_Rn02_00325045 predicted 469
7 SASI_Rn02_00325046 predicted 481
8 SASI_Rn02_00325047 predicted 529
9 SASI_Rn02_00325048 predicted 434
10 SASI_Rn02_00325049 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196965 predicted 574
2 SASI_Mm01_00196966 predicted 851
3 SASI_Mm01_00196967 predicted 789
4 SASI_Mm01_00196968 predicted 1048
5 SASI_Mm01_00196969 predicted 557
6 SASI_Mm01_00196970 predicted 1006
7 SASI_Mm01_00196971 predicted 876
8 SASI_Mm02_00345730 predicted 683
9 SASI_Mm01_00196972 predicted 493
10 SASI_Mm01_00196973 predicted 876
11 SASI_Mm01_00196974 predicted 799
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033575
VALIDATED
DUSP28 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 28
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033575.1-765s21c1
Sequence:CCGGTCACGCTGTGCGTCAACGTCTCTCGAGAGACGTTGACGCACAGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033575.1-1260s21c1
Sequence:GTACCGGCGGATTAGATGTTGCTATATGCTCGAGCATATAGCAACATCTAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033575.1-1151s21c1
Sequence:CCGGCCTGAGGCTTGAAGCTTGAAGCTCGAGCTTCAAGCTTCAAGCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033575.1-926s21c1
Sequence:CCGGTGCCTAGTCTACTGCAAGAACCTCGAGGTTCTTGCAGTAGACTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033575.1-1071s21c1
Sequence:CCGGGGTCTCAGCTCCAGAAGTATGCTCGAGCATACTTCTGGAGCTGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033575.1-1259s1c1
Sequence:CCGGCCGGATTAGATGTTGCTATATCTCGAGATATAGCAACATCTAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033575.1-1070s1c1
Sequence:CCGGTGGTCTCAGCTCCAGAAGTATCTCGAGATACTTCTGGAGCTGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033575.1-1081s1c1
Sequence:CCGGCCAGAAGTATGAGGAGGCCCTCTCGAGAGGGCCTCCTCATACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033575.1-925s1c1
Sequence:CCGGCTGCCTAGTCTACTGCAAGAACTCGAGTTCTTGCAGTAGACTAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033575.1-922s1c1
Sequence:CCGGCGCCTGCCTAGTCTACTGCAACTCGAGTTGCAGTAGACTAGGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033575
VALIDATED
DUSP28 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 28
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033575.1-765s21c1
Sequence:CCGGTCACGCTGTGCGTCAACGTCTCTCGAGAGACGTTGACGCACAGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033575.1-1260s21c1
Sequence:GTACCGGCGGATTAGATGTTGCTATATGCTCGAGCATATAGCAACATCTAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033575.1-1151s21c1
Sequence:CCGGCCTGAGGCTTGAAGCTTGAAGCTCGAGCTTCAAGCTTCAAGCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033575.1-926s21c1
Sequence:CCGGTGCCTAGTCTACTGCAAGAACCTCGAGGTTCTTGCAGTAGACTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033575.1-1071s21c1
Sequence:CCGGGGTCTCAGCTCCAGAAGTATGCTCGAGCATACTTCTGGAGCTGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033575.1-1259s1c1
Sequence:CCGGCCGGATTAGATGTTGCTATATCTCGAGATATAGCAACATCTAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033575.1-1070s1c1
Sequence:CCGGTGGTCTCAGCTCCAGAAGTATCTCGAGATACTTCTGGAGCTGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033575.1-1081s1c1
Sequence:CCGGCCAGAAGTATGAGGAGGCCCTCTCGAGAGGGCCTCCTCATACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033575.1-925s1c1
Sequence:CCGGCTGCCTAGTCTACTGCAAGAACTCGAGTTCTTGCAGTAGACTAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033575.1-922s1c1
Sequence:CCGGCGCCTGCCTAGTCTACTGCAACTCGAGTTGCAGTAGACTAGGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033575
VALIDATED
DUSP28 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 28
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033575.1-765s21c1
Sequence:CCGGTCACGCTGTGCGTCAACGTCTCTCGAGAGACGTTGACGCACAGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033575.1-1260s21c1
Sequence:GTACCGGCGGATTAGATGTTGCTATATGCTCGAGCATATAGCAACATCTAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033575.1-1151s21c1
Sequence:CCGGCCTGAGGCTTGAAGCTTGAAGCTCGAGCTTCAAGCTTCAAGCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033575.1-926s21c1
Sequence:CCGGTGCCTAGTCTACTGCAAGAACCTCGAGGTTCTTGCAGTAGACTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001033575.1-1071s21c1
Sequence:CCGGGGTCTCAGCTCCAGAAGTATGCTCGAGCATACTTCTGGAGCTGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033575.1-1259s1c1
Sequence:CCGGCCGGATTAGATGTTGCTATATCTCGAGATATAGCAACATCTAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033575.1-1070s1c1
Sequence:CCGGTGGTCTCAGCTCCAGAAGTATCTCGAGATACTTCTGGAGCTGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033575.1-1081s1c1
Sequence:CCGGCCAGAAGTATGAGGAGGCCCTCTCGAGAGGGCCTCCTCATACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033575.1-925s1c1
Sequence:CCGGCTGCCTAGTCTACTGCAAGAACTCGAGTTCTTGCAGTAGACTAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033575.1-922s1c1
Sequence:CCGGCGCCTGCCTAGTCTACTGCAACTCGAGTTGCAGTAGACTAGGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175118
DUSP28 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 28
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000081048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175118.2-665s1c1
Sequence:CCGGCCAAATCCAAACCAGCACGTTCTCGAGAACGTGCTGGTTTGGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175118.2-194s1c1
Sequence:CCGGCCCGTGTTCGACGACCCAGCTCTCGAGAGCTGGGTCGTCGAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175118.2-399s1c1
Sequence:CCGGGCCCGGTAGCCGAGCCCAATTCTCGAGAATTGGGCTCGGCTACCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175118.2-283s1c1
Sequence:CCGGCTGTCTCGTGTACTGCAAGAACTCGAGTTCTTGCAGTACACGAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175118
DUSP28 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 28
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000081048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175118.2-665s1c1
Sequence:CCGGCCAAATCCAAACCAGCACGTTCTCGAGAACGTGCTGGTTTGGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175118.2-194s1c1
Sequence:CCGGCCCGTGTTCGACGACCCAGCTCTCGAGAGCTGGGTCGTCGAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175118.2-399s1c1
Sequence:CCGGGCCCGGTAGCCGAGCCCAATTCTCGAGAATTGGGCTCGGCTACCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175118.2-283s1c1
Sequence:CCGGCTGTCTCGTGTACTGCAAGAACTCGAGTTCTTGCAGTACACGAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175118
DUSP28 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 28
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000081048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175118.2-665s1c1
Sequence:CCGGCCAAATCCAAACCAGCACGTTCTCGAGAACGTGCTGGTTTGGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175118.2-194s1c1
Sequence:CCGGCCCGTGTTCGACGACCCAGCTCTCGAGAGCTGGGTCGTCGAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175118.2-399s1c1
Sequence:CCGGGCCCGGTAGCCGAGCCCAATTCTCGAGAATTGGGCTCGGCTACCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175118.2-283s1c1
Sequence:CCGGCTGTCTCGTGTACTGCAAGAACTCGAGTTCTTGCAGTACACGAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks