EMAIL THIS PAGE TO A FRIEND

DUSP2

dual specificity phosphatase 2

102 Gene Product Result for
Synonyms: PAC-1 PAC1
UniProtKB ID: Q05923, Q53T45
Gene ID:
Human(1844) Summary: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1 and ERK2, is predominantly expressed in hematopoietic tissues, and is localized in the nucleus. [provided by RefSeq, Jul 2008]
Mouse(13537) dual specificity phosphatase 2
Rat(311406) dual specificity phosphatase 2
domestic guinea pig(100723186) dual specificity phosphatase 2
naked mole-rat(101702046) dual specificity phosphatase 2
sheep(101115699) dual specificity phosphatase 2
Zebrafish(445057) dual specificity phosphatase 2
dog(611653) dual specificity phosphatase 2
cow(539140) dual specificity phosphatase 2
domestic cat(101090684) dual specificity phosphatase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004418 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010090 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010090 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010090 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004418 Rosetta Predictions human pricing
NM_001012089 Rosetta Predictions rat pricing
XM_575231 Rosetta Predictions rat pricing
NM_010090 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034089 predicted 882
2 SASI_Hs01_00034090 predicted 712
3 SASI_Hs01_00034091 predicted 924
4 SASI_Hs01_00034092 predicted 599
5 SASI_Hs01_00034093 predicted 798
6 SASI_Hs01_00034094 predicted 778
7 SASI_Hs02_00337566 predicted 1283
8 SASI_Hs01_00034096 predicted 676
9 SASI_Hs01_00034098 predicted 800
10 SASI_Hs02_00337567 predicted 1292
11 SASI_Hs01_00034095 predicted 672
12 SASI_Hs01_00034097 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072628 predicted 1401
2 SASI_Rn01_00072629 predicted 1403
3 SASI_Rn01_00072630 predicted 1293
4 SASI_Rn01_00072631 predicted 1260
5 SASI_Rn01_00072633 predicted 917
6 SASI_Rn01_00072634 predicted 912
7 SASI_Rn01_00072635 predicted 593
8 SASI_Rn01_00072636 predicted 1191
9 SASI_Rn02_00200218 predicted 491
10 SASI_Rn02_00200219 predicted 1137
11 SASI_Rn01_00072632 predicted 1364
12 SASI_Rn01_00072637 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131927 predicted 359
2 SASI_Rn01_00131928 predicted 338
3 SASI_Rn01_00131929 predicted 338
4 SASI_Rn01_00131930 predicted 279
5 SASI_Rn01_00131931 predicted 305
6 SASI_Rn01_00131932 predicted 313
7 SASI_Rn01_00131933 predicted 340
8 SASI_Rn01_00131934 predicted 214
9 SASI_Rn01_00131935 predicted 365
10 SASI_Rn01_00131936 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187168 predicted 463
2 SASI_Mm01_00187169 predicted 816
3 SASI_Mm01_00187170 predicted 1188
4 SASI_Mm01_00187171 predicted 932
5 SASI_Mm01_00187172 predicted 1055
6 SASI_Mm01_00187173 predicted 676
7 SASI_Mm01_00187175 predicted 1190
8 SASI_Mm01_00187176 predicted 1136
9 SASI_Mm01_00187177 predicted 810
10 SASI_Mm02_00317784 predicted 744
11 SASI_Mm01_00187174 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004418
VALIDATED
DUSP2 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004418.3-1261s21c1
Sequence:CCGGCAAGGGTGTGTCTGCTCTTTCCTCGAGGAAAGAGCAGACACACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004418.3-892s21c1
Sequence:CCGGTGGCATACCTCATGCAGAGTCCTCGAGGACTCTGCATGAGGTATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004418.3-763s21c1
Sequence:CCGGACAACCAGATGGTGGAGATCACTCGAGTGATCTCCACCATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004418.3-796s21c1
Sequence:CCGGAGGAGGCCATAGGCTTCATTGCTCGAGCAATGAAGCCTATGGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004418.3-1300s21c1
Sequence:CCGGGAAATCAGCTAGACGCTATACCTCGAGGTATAGCGTCTAGCTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004418.3-929s21c1
Sequence:CCGGCGAGGCCTTTGACTTCGTTAACTCGAGTTAACGAAGTCAAAGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004418.3-715s21c1
Sequence:CCGGCCAACCACTTTGAGGGCCTTTCTCGAGAAAGGCCCTCAAAGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004418.3-737s21c1
Sequence:CCGGCCGCTACAAGAGTATCCCTGTCTCGAGACAGGGATACTCTTGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004418.3-608s21c1
Sequence:CCGGGGAGATCTTGCCCTACCTGTTCTCGAGAACAGGTAGGGCAAGATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004418.2-1499s1c1
Sequence:CCGGTGTGTCTGTCTGTGAGCCTTTCTCGAGAAAGGCTCACAGACAGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051907    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_004418.2-500s1c1
Sequence:CCGGTGTCCCGATCTGTGCTCTGAGCTCGAGCTCAGAGCACAGATCGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004418.2-883s1c1
Sequence:CCGGCATCTGTCTGGCATACCTCATCTCGAGATGAGGTATGCCAGACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004418.2-452s1c1
Sequence:CCGGACTGCCGTGTACTTCCTGCGACTCGAGTCGCAGGAAGTACACGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004418
VALIDATED
DUSP2 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004418.3-1261s21c1
Sequence:CCGGCAAGGGTGTGTCTGCTCTTTCCTCGAGGAAAGAGCAGACACACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004418.3-892s21c1
Sequence:CCGGTGGCATACCTCATGCAGAGTCCTCGAGGACTCTGCATGAGGTATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004418.3-763s21c1
Sequence:CCGGACAACCAGATGGTGGAGATCACTCGAGTGATCTCCACCATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004418.3-796s21c1
Sequence:CCGGAGGAGGCCATAGGCTTCATTGCTCGAGCAATGAAGCCTATGGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004418.3-1300s21c1
Sequence:CCGGGAAATCAGCTAGACGCTATACCTCGAGGTATAGCGTCTAGCTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004418.3-929s21c1
Sequence:CCGGCGAGGCCTTTGACTTCGTTAACTCGAGTTAACGAAGTCAAAGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004418.3-715s21c1
Sequence:CCGGCCAACCACTTTGAGGGCCTTTCTCGAGAAAGGCCCTCAAAGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004418.3-737s21c1
Sequence:CCGGCCGCTACAAGAGTATCCCTGTCTCGAGACAGGGATACTCTTGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004418.3-608s21c1
Sequence:CCGGGGAGATCTTGCCCTACCTGTTCTCGAGAACAGGTAGGGCAAGATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004418.2-1499s1c1
Sequence:CCGGTGTGTCTGTCTGTGAGCCTTTCTCGAGAAAGGCTCACAGACAGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051907    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_004418.2-500s1c1
Sequence:CCGGTGTCCCGATCTGTGCTCTGAGCTCGAGCTCAGAGCACAGATCGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004418.2-883s1c1
Sequence:CCGGCATCTGTCTGGCATACCTCATCTCGAGATGAGGTATGCCAGACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004418.2-452s1c1
Sequence:CCGGACTGCCGTGTACTTCCTGCGACTCGAGTCGCAGGAAGTACACGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004418
VALIDATED
DUSP2 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004418.3-1261s21c1
Sequence:CCGGCAAGGGTGTGTCTGCTCTTTCCTCGAGGAAAGAGCAGACACACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004418.3-892s21c1
Sequence:CCGGTGGCATACCTCATGCAGAGTCCTCGAGGACTCTGCATGAGGTATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004418.3-763s21c1
Sequence:CCGGACAACCAGATGGTGGAGATCACTCGAGTGATCTCCACCATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004418.3-796s21c1
Sequence:CCGGAGGAGGCCATAGGCTTCATTGCTCGAGCAATGAAGCCTATGGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004418.3-1300s21c1
Sequence:CCGGGAAATCAGCTAGACGCTATACCTCGAGGTATAGCGTCTAGCTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004418.3-929s21c1
Sequence:CCGGCGAGGCCTTTGACTTCGTTAACTCGAGTTAACGAAGTCAAAGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004418.3-715s21c1
Sequence:CCGGCCAACCACTTTGAGGGCCTTTCTCGAGAAAGGCCCTCAAAGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004418.3-737s21c1
Sequence:CCGGCCGCTACAAGAGTATCCCTGTCTCGAGACAGGGATACTCTTGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004418.3-608s21c1
Sequence:CCGGGGAGATCTTGCCCTACCTGTTCTCGAGAACAGGTAGGGCAAGATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004418.2-1499s1c1
Sequence:CCGGTGTGTCTGTCTGTGAGCCTTTCTCGAGAAAGGCTCACAGACAGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051907    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_004418.2-500s1c1
Sequence:CCGGTGTCCCGATCTGTGCTCTGAGCTCGAGCTCAGAGCACAGATCGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004418.2-883s1c1
Sequence:CCGGCATCTGTCTGGCATACCTCATCTCGAGATGAGGTATGCCAGACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004418.2-452s1c1
Sequence:CCGGACTGCCGTGTACTTCCTGCGACTCGAGTCGCAGGAAGTACACGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010090
VALIDATED
DUSP2 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010090.2-469s21c1
Sequence:CCGGCTTCTTGCGAGGCGGTTTCAACTCGAGTTGAAACCGCCTCGCAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010090.2-891s21c1
Sequence:CCGGTCTGCCTGGCATACCTGATTCCTCGAGGAATCAGGTATGCCAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010090.2-768s21c1
Sequence:GTACCGGATAACCAGATGGTGGAGATAACTCGAGTTATCTCCACCATCTGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010090.2-1433s21c1
Sequence:CCGGGTGTGGGCATCTCGCTGTAATCTCGAGATTACAGCGAGATGCCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010090.2-801s21c1
Sequence:CCGGAGGAGGCTATCAGCTTCATAGCTCGAGCTATGAAGCTGATAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010090.2-938s1c1
Sequence:CCGGGCCTTTGACTTTGTTAAGCAACTCGAGTTGCTTAACAAAGTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010090.2-350s1c1
Sequence:CCGGCGTGCCGTGGTGCTGGATGAACTCGAGTTCATCCAGCACCACGGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010090.2-607s1c1
Sequence:CCGGTCCTGTGGAAATCTTGCCCTACTCGAGTAGGGCAAGATTTCCACAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010090.2-767s1c1
Sequence:CCGGGATAACCAGATGGTGGAGATACTCGAGTATCTCCACCATCTGGTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010090.2-800s1c1
Sequence:CCGGCAGGAGGCTATCAGCTTCATACTCGAGTATGAAGCTGATAGCCTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010090
VALIDATED
DUSP2 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010090.2-469s21c1
Sequence:CCGGCTTCTTGCGAGGCGGTTTCAACTCGAGTTGAAACCGCCTCGCAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010090.2-891s21c1
Sequence:CCGGTCTGCCTGGCATACCTGATTCCTCGAGGAATCAGGTATGCCAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010090.2-768s21c1
Sequence:GTACCGGATAACCAGATGGTGGAGATAACTCGAGTTATCTCCACCATCTGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010090.2-1433s21c1
Sequence:CCGGGTGTGGGCATCTCGCTGTAATCTCGAGATTACAGCGAGATGCCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010090.2-801s21c1
Sequence:CCGGAGGAGGCTATCAGCTTCATAGCTCGAGCTATGAAGCTGATAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010090.2-938s1c1
Sequence:CCGGGCCTTTGACTTTGTTAAGCAACTCGAGTTGCTTAACAAAGTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010090.2-350s1c1
Sequence:CCGGCGTGCCGTGGTGCTGGATGAACTCGAGTTCATCCAGCACCACGGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010090.2-607s1c1
Sequence:CCGGTCCTGTGGAAATCTTGCCCTACTCGAGTAGGGCAAGATTTCCACAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010090.2-767s1c1
Sequence:CCGGGATAACCAGATGGTGGAGATACTCGAGTATCTCCACCATCTGGTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010090.2-800s1c1
Sequence:CCGGCAGGAGGCTATCAGCTTCATACTCGAGTATGAAGCTGATAGCCTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010090
VALIDATED
DUSP2 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010090.2-469s21c1
Sequence:CCGGCTTCTTGCGAGGCGGTTTCAACTCGAGTTGAAACCGCCTCGCAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010090.2-891s21c1
Sequence:CCGGTCTGCCTGGCATACCTGATTCCTCGAGGAATCAGGTATGCCAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010090.2-768s21c1
Sequence:GTACCGGATAACCAGATGGTGGAGATAACTCGAGTTATCTCCACCATCTGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010090.2-1433s21c1
Sequence:CCGGGTGTGGGCATCTCGCTGTAATCTCGAGATTACAGCGAGATGCCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010090.2-801s21c1
Sequence:CCGGAGGAGGCTATCAGCTTCATAGCTCGAGCTATGAAGCTGATAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010090.2-938s1c1
Sequence:CCGGGCCTTTGACTTTGTTAAGCAACTCGAGTTGCTTAACAAAGTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010090.2-350s1c1
Sequence:CCGGCGTGCCGTGGTGCTGGATGAACTCGAGTTCATCCAGCACCACGGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010090.2-607s1c1
Sequence:CCGGTCCTGTGGAAATCTTGCCCTACTCGAGTAGGGCAAGATTTCCACAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010090.2-767s1c1
Sequence:CCGGGATAACCAGATGGTGGAGATACTCGAGTATCTCCACCATCTGGTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010090.2-800s1c1
Sequence:CCGGCAGGAGGCTATCAGCTTCATACTCGAGTATGAAGCTGATAGCCTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks