EMAIL THIS PAGE TO A FRIEND

DUSP3

dual specificity phosphatase 3

163 Gene Product Result for
Synonyms: VHR
UniProtKB ID: P51452, D3DX45, Q5U0J1
Gene ID:
Human(1845) Summary: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene maps in a region that contains the BRCA1 locus which confers susceptibility to breast and ovarian cancer. Although DUSP3 is expressed in both breast and ovarian tissues, mutation screening in breast cancer pedigrees and in sporadic tumors was negative, leading to the conclusion that this gene is not BRCA1. [provided by RefSeq, Jul 2008]
Mouse(72349) dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related)
Rat(498003) dual specificity phosphatase 3
chicken(425527) dual specificity phosphatase 3
dog(480505) dual specificity phosphatase 3
cow(615432) dual specificity phosphatase 3
domestic cat(101083983) dual specificity phosphatase 3
sheep(101114374) dual specificity phosphatase 3
naked mole-rat(101702703) dual specificity phosphatase 3
domestic guinea pig(100730437) dual specificity phosphatase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N7537 NSC 663284 ≥98% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004090 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004090 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004090 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028207 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028207 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028207 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004090 Rosetta Predictions human pricing
XM_001081500 Rosetta Predictions rat pricing
XM_573199 Rosetta Predictions rat pricing
NM_028207 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183472 predicted 1001
2 SASI_Hs02_00336893 predicted 471
3 SASI_Hs01_00183474 predicted 482
4 SASI_Hs01_00183475 predicted 263
5 SASI_Hs02_00336894 predicted 843
6 SASI_Hs01_00183476 predicted 504
7 SASI_Hs01_00183477 predicted 228
8 SASI_Hs01_00183478 predicted 1026
9 SASI_Hs01_00183479 predicted 935
10 SASI_Hs01_00183480 predicted 840
11 SASI_Hs01_00183473 predicted 347
12 SASI_Hs01_00183481 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372167 predicted 525
2 SASI_Rn02_00372168 predicted 475
3 SASI_Rn02_00372169 predicted 473
4 SASI_Rn02_00372170 predicted 507
5 SASI_Rn02_00372171 predicted 495
6 SASI_Rn02_00372172 predicted 536
7 SASI_Rn02_00372173 predicted 709
8 SASI_Rn02_00372174 predicted 688
9 SASI_Rn02_00372175 predicted 499
10 SASI_Rn02_00372176 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399984 predicted 520
2 SASI_Rn02_00399985 predicted 476
3 SASI_Rn02_00399986 predicted 473
4 SASI_Rn02_00399987 predicted 510
5 SASI_Rn02_00399988 predicted 500
6 SASI_Rn02_00399989 predicted 541
7 SASI_Rn02_00399990 predicted 712
8 SASI_Rn02_00399991 predicted 685
9 SASI_Rn02_00399992 predicted 494
10 SASI_Rn02_00399993 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020753 predicted 778
2 SASI_Mm02_00333530 predicted 252
3 SASI_Mm01_00020754 predicted 437
4 SASI_Mm01_00020756 predicted 800
5 SASI_Mm01_00020757 predicted 253
6 SASI_Mm01_00020758 predicted 480
7 SASI_Mm01_00020759 predicted 802
8 SASI_Mm02_00333531 predicted 831
9 SASI_Mm01_00020760 predicted 320
10 SASI_Mm01_00020761 predicted 274
11 SASI_Mm01_00020755 predicted 336
12 SASI_Mm01_00020762 predicted 542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004090
VALIDATED
DUSP3 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004090.2-1270s1c1
Sequence:CCGGCCCTCCTAAATCCATAGAGTTCTCGAGAACTCTATGGATTTAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004090.2-570s1c1
Sequence:CCGGGCTCAATGACAGACTAGCCAACTCGAGTTGGCTAGTCTGTCATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004090.2-513s1c1
Sequence:CCGGCGTGAGGCAGAACCGTGAGATCTCGAGATCTCACGGTTCTGCCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004090.2-297s1c1
Sequence:CCGGCGGCATCACATACCTGGGCATCTCGAGATGCCCAGGTATGTGATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004090.2-453s1c1
Sequence:CCGGGCTAGTTATCGCCTACCTCATCTCGAGATGAGGTAGGCGATAACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004090.3-487s21c1
Sequence:CCGGCTACCTCATGATGCGGCAGAACTCGAGTTCTGCCGCATCATGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004090.3-689s21c1
Sequence:CCGGTGTCCCGAGCTGCCATGTTTACTCGAGTAAACATGGCAGCTCGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004090.3-441s21c1
Sequence:CCGGTCCACTGCCGGGAAGGTTATACTCGAGTATAACCTTCCCGGCAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004090.3-363s21c1
Sequence:CCGGTCAACCTCAGCGCTTACTTTGCTCGAGCAAAGTAAGCGCTGAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004090.3-535s21c1
Sequence:CCGGCGTGAGGCAGAACCGTGAGATCTCGAGATCTCACGGTTCTGCCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004090.3-309s21c1
Sequence:CCGGACAAGGACTCCGGCATCACATCTCGAGATGTGATGCCGGAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_004090.3-1038s21c1
Sequence:CCGGACACCTTGAGCCCTAGTAAAGCTCGAGCTTTACTAGGGCTCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004090.3-279s21c1
Sequence:CCGGTCATGCACGTCAACACCAATGCTCGAGCATTGGTGTTGACGTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004090
VALIDATED
DUSP3 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004090.2-1270s1c1
Sequence:CCGGCCCTCCTAAATCCATAGAGTTCTCGAGAACTCTATGGATTTAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004090.2-570s1c1
Sequence:CCGGGCTCAATGACAGACTAGCCAACTCGAGTTGGCTAGTCTGTCATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004090.2-513s1c1
Sequence:CCGGCGTGAGGCAGAACCGTGAGATCTCGAGATCTCACGGTTCTGCCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004090.2-297s1c1
Sequence:CCGGCGGCATCACATACCTGGGCATCTCGAGATGCCCAGGTATGTGATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004090.2-453s1c1
Sequence:CCGGGCTAGTTATCGCCTACCTCATCTCGAGATGAGGTAGGCGATAACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004090.3-487s21c1
Sequence:CCGGCTACCTCATGATGCGGCAGAACTCGAGTTCTGCCGCATCATGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004090.3-689s21c1
Sequence:CCGGTGTCCCGAGCTGCCATGTTTACTCGAGTAAACATGGCAGCTCGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004090.3-441s21c1
Sequence:CCGGTCCACTGCCGGGAAGGTTATACTCGAGTATAACCTTCCCGGCAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004090.3-363s21c1
Sequence:CCGGTCAACCTCAGCGCTTACTTTGCTCGAGCAAAGTAAGCGCTGAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004090.3-535s21c1
Sequence:CCGGCGTGAGGCAGAACCGTGAGATCTCGAGATCTCACGGTTCTGCCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004090.3-309s21c1
Sequence:CCGGACAAGGACTCCGGCATCACATCTCGAGATGTGATGCCGGAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_004090.3-1038s21c1
Sequence:CCGGACACCTTGAGCCCTAGTAAAGCTCGAGCTTTACTAGGGCTCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004090.3-279s21c1
Sequence:CCGGTCATGCACGTCAACACCAATGCTCGAGCATTGGTGTTGACGTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004090
VALIDATED
DUSP3 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004090.2-1270s1c1
Sequence:CCGGCCCTCCTAAATCCATAGAGTTCTCGAGAACTCTATGGATTTAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004090.2-570s1c1
Sequence:CCGGGCTCAATGACAGACTAGCCAACTCGAGTTGGCTAGTCTGTCATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004090.2-513s1c1
Sequence:CCGGCGTGAGGCAGAACCGTGAGATCTCGAGATCTCACGGTTCTGCCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004090.2-297s1c1
Sequence:CCGGCGGCATCACATACCTGGGCATCTCGAGATGCCCAGGTATGTGATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004090.2-453s1c1
Sequence:CCGGGCTAGTTATCGCCTACCTCATCTCGAGATGAGGTAGGCGATAACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004090.3-487s21c1
Sequence:CCGGCTACCTCATGATGCGGCAGAACTCGAGTTCTGCCGCATCATGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004090.3-689s21c1
Sequence:CCGGTGTCCCGAGCTGCCATGTTTACTCGAGTAAACATGGCAGCTCGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004090.3-441s21c1
Sequence:CCGGTCCACTGCCGGGAAGGTTATACTCGAGTATAACCTTCCCGGCAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004090.3-363s21c1
Sequence:CCGGTCAACCTCAGCGCTTACTTTGCTCGAGCAAAGTAAGCGCTGAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004090.3-535s21c1
Sequence:CCGGCGTGAGGCAGAACCGTGAGATCTCGAGATCTCACGGTTCTGCCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004090.3-309s21c1
Sequence:CCGGACAAGGACTCCGGCATCACATCTCGAGATGTGATGCCGGAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_004090.3-1038s21c1
Sequence:CCGGACACCTTGAGCCCTAGTAAAGCTCGAGCTTTACTAGGGCTCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004090.3-279s21c1
Sequence:CCGGTCATGCACGTCAACACCAATGCTCGAGCATTGGTGTTGACGTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028207
DUSP3 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028207.1-759s1c1
Sequence:CCGGCCTAAGAAGTTCTGCTCCTTACTCGAGTAAGGAGCAGAACTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028207.1-282s1c1
Sequence:CCGGCATCACCTACTTGGGCATCAACTCGAGTTGATGCCCAAGTAGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028207.1-334s1c1
Sequence:CCGGGCTTACTTTGAAAGGGCCACACTCGAGTGTGGCCCTTTCAAAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028207.1-259s1c1
Sequence:CCGGGCTAGCTTCTACGAGGATTCTCTCGAGAGAATCCTCGTAGAAGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028207.1-138s1c1
Sequence:CCGGCCCGAGGGTCTACGTGGGCAACTCGAGTTGCCCACGTAGACCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028207
DUSP3 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028207.1-759s1c1
Sequence:CCGGCCTAAGAAGTTCTGCTCCTTACTCGAGTAAGGAGCAGAACTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028207.1-282s1c1
Sequence:CCGGCATCACCTACTTGGGCATCAACTCGAGTTGATGCCCAAGTAGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028207.1-334s1c1
Sequence:CCGGGCTTACTTTGAAAGGGCCACACTCGAGTGTGGCCCTTTCAAAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028207.1-259s1c1
Sequence:CCGGGCTAGCTTCTACGAGGATTCTCTCGAGAGAATCCTCGTAGAAGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028207.1-138s1c1
Sequence:CCGGCCCGAGGGTCTACGTGGGCAACTCGAGTTGCCCACGTAGACCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028207
DUSP3 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028207.1-759s1c1
Sequence:CCGGCCTAAGAAGTTCTGCTCCTTACTCGAGTAAGGAGCAGAACTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028207.1-282s1c1
Sequence:CCGGCATCACCTACTTGGGCATCAACTCGAGTTGATGCCCAAGTAGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028207.1-334s1c1
Sequence:CCGGGCTTACTTTGAAAGGGCCACACTCGAGTGTGGCCCTTTCAAAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028207.1-259s1c1
Sequence:CCGGGCTAGCTTCTACGAGGATTCTCTCGAGAGAATCCTCGTAGAAGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028207.1-138s1c1
Sequence:CCGGCCCGAGGGTCTACGTGGGCAACTCGAGTTGCCCACGTAGACCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks