EMAIL THIS PAGE TO A FRIEND

DUSP4

dual specificity phosphatase 4

109 Gene Product Result for
Synonyms: HVH2 MKP-2 MKP2 TYP
UniProtKB ID: Q13115, B2RBU5, D3DSU4, G5E930, Q13524
Gene ID:
Human(1846) Summary: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, ERK2 and JNK, is expressed in a variety of tissues, and is localized in the nucleus. Two alternatively spliced transcript variants, encoding distinct isoforms, have been observed for this gene. In addition, multiple polyadenylation sites have been reported. [provided by RefSeq, Jul 2008]
Mouse(319520) dual specificity phosphatase 4
Rat(60587) dual specificity phosphatase 4
Zebrafish(394146) dual specificity phosphatase 4
cow(540380) dual specificity phosphatase 4
domestic cat(101088832) dual specificity phosphatase 4
dog(482880) dual specificity phosphatase 4
chicken(395642) dual specificity phosphatase 4
domestic guinea pig(100728293) dual specificity phosphatase 4
sheep(101103535) dual specificity phosphatase 4
Domestic Rabbit(100351542) dual specificity phosphatase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001394 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001394 Rosetta Predictions human pricing
NM_057158 Rosetta Predictions human pricing
NM_022199 Rosetta Predictions rat pricing
NM_176933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056645 predicted 1956
2 SASI_Hs01_00056646 predicted 1299
3 SASI_Hs01_00056647 predicted 1629
4 SASI_Hs01_00056648 predicted 1228
5 SASI_Hs01_00056649 predicted 1756
6 SASI_Hs01_00056650 predicted 1473
7 SASI_Hs01_00056651 predicted 1087
8 SASI_Hs01_00056652 predicted 2021
9 SASI_Hs01_00056653 predicted 1728
10 SASI_Hs01_00056654 predicted 1804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134070 predicted 2857
2 SASI_Hs01_00134071 predicted 2200
3 SASI_Hs01_00134072 predicted 2529
4 SASI_Hs01_00134073 predicted 2127
5 SASI_Hs01_00134074 predicted 2660
6 SASI_Hs01_00134075 predicted 2365
7 SASI_Hs01_00134076 predicted 1981
8 SASI_Hs02_00362013 predicted 1981
9 SASI_Hs01_00134077 predicted 2925
10 SASI_Hs01_00134078 predicted 2624
11 SASI_Hs01_00134079 predicted 2710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098520 predicted 939
2 SASI_Rn01_00098521 predicted 580
3 SASI_Rn01_00098522 predicted 313
4 SASI_Rn02_00262950 predicted 844
5 SASI_Rn01_00098523 predicted 695
6 SASI_Rn01_00098524 predicted 752
7 SASI_Rn01_00098525 predicted 725
8 SASI_Rn01_00098526 predicted 757
9 SASI_Rn01_00098527 predicted 367
10 SASI_Rn02_00262951 predicted 919
11 SASI_Rn01_00098518 predicted 411
12 SASI_Rn01_00098519 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146062 predicted 1491
2 SASI_Mm01_00146063 predicted 1620
3 SASI_Mm01_00146064 predicted 1507
4 SASI_Mm01_00146065 predicted 1575
5 SASI_Mm01_00146066 predicted 1808
6 SASI_Mm01_00146067 predicted 798
7 SASI_Mm01_00146068 predicted 1587
8 SASI_Mm01_00146069 predicted 1656
9 SASI_Mm01_00146070 predicted 809
10 SASI_Mm02_00346833 predicted 441
11 SASI_Mm01_00146061 predicted 1468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001394
DUSP4 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001394.5-1475s21c1
Sequence:CCGGCGCAGTTCGTCTTCAGCTTTCCTCGAGGAAAGCTGAAGACGAACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001394.5-1164s21c1
Sequence:CCGGGTTCATGGAAGCCATAGAGTACTCGAGTACTCTATGGCTTCCATGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001394.5-1729s21c1
Sequence:CCGGGGCAATAAGGACTCCGAATACCTCGAGGTATTCGGAGTCCTTATTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001394.5-1302s21c1
Sequence:CCGGGGAGGCCTTCGAGTTCGTTAACTCGAGTTAACGAACTCGAAGGCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001394.5-1091s21c1
Sequence:CCGGACCACTTTGAAGGACACTATCCTCGAGGATAGTGTCCTTCAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001394.4-1768s1c1
Sequence:CCGGCACTCCAACTTAGAGCAATAACTCGAGTTATTGCTCTAAGTTGGAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001394.4-1267s1c1
Sequence:CCGGGCCTACCTGATGATGAAGAAACTCGAGTTTCTTCATCATCAGGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001394.4-687s1c1
Sequence:CCGGCGGCCTCTACTCGGCGGTCATCTCGAGATGACCGCCGAGTAGAGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001394.4-1125s1c1
Sequence:CCGGCCCAGTGGAAGATAACCACAACTCGAGTTGTGGTTATCTTCCACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001394.4-1474s1c1
Sequence:CCGGTCGCAGTTCGTCTTCAGCTTTCTCGAGAAAGCTGAAGACGAACTGCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001394
DUSP4 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001394.5-1475s21c1
Sequence:CCGGCGCAGTTCGTCTTCAGCTTTCCTCGAGGAAAGCTGAAGACGAACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001394.5-1164s21c1
Sequence:CCGGGTTCATGGAAGCCATAGAGTACTCGAGTACTCTATGGCTTCCATGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001394.5-1729s21c1
Sequence:CCGGGGCAATAAGGACTCCGAATACCTCGAGGTATTCGGAGTCCTTATTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001394.5-1302s21c1
Sequence:CCGGGGAGGCCTTCGAGTTCGTTAACTCGAGTTAACGAACTCGAAGGCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001394.5-1091s21c1
Sequence:CCGGACCACTTTGAAGGACACTATCCTCGAGGATAGTGTCCTTCAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001394.4-1768s1c1
Sequence:CCGGCACTCCAACTTAGAGCAATAACTCGAGTTATTGCTCTAAGTTGGAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001394.4-1267s1c1
Sequence:CCGGGCCTACCTGATGATGAAGAAACTCGAGTTTCTTCATCATCAGGTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001394.4-687s1c1
Sequence:CCGGCGGCCTCTACTCGGCGGTCATCTCGAGATGACCGCCGAGTAGAGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001394.4-1125s1c1
Sequence:CCGGCCCAGTGGAAGATAACCACAACTCGAGTTGTGGTTATCTTCCACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001394.4-1474s1c1
Sequence:CCGGTCGCAGTTCGTCTTCAGCTTTCTCGAGAAAGCTGAAGACGAACTGCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001394
DUSP4 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001394.5-1475s21c1
Sequence:CCGGCGCAGTTCGTCTTCAGCTTTCCTCGAGGAAAGCTGAAGACGAACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001394.5-1164s21c1
Sequence:CCGGGTTCATGGAAGCCATAGAGTACTCGAGTACTCTATGGCTTCCATGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001394.5-1729s21c1
Sequence:CCGGGGCAATAAGGACTCCGAATACCTCGAGGTATTCGGAGTCCTTATTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001394.5-1302s21c1
Sequence:CCGGGGAGGCCTTCGAGTTCGTTAACTCGAGTTAACGAACTCGAAGGCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001394.5-1091s21c1
Sequence:CCGGACCACTTTGAAGGACACTATCCTCGAGGATAGTGTCCTTCAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001394.4-1768s1c1
Sequence:CCGGCACTCCAACTTAGAGCAATAACTCGAGTTATTGCTCTAAGTTGGAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001394.4-1267s1c1
Sequence:CCGGGCCTACCTGATGATGAAGAAACTCGAGTTTCTTCATCATCAGGTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001394.4-687s1c1
Sequence:CCGGCGGCCTCTACTCGGCGGTCATCTCGAGATGACCGCCGAGTAGAGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001394.4-1125s1c1
Sequence:CCGGCCCAGTGGAAGATAACCACAACTCGAGTTGTGGTTATCTTCCACTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001394.4-1474s1c1
Sequence:CCGGTCGCAGTTCGTCTTCAGCTTTCTCGAGAAAGCTGAAGACGAACTGCGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176933
VALIDATED
DUSP4 MISSION shRNA Bacterial Glycerol Stock
dual specificity phosphatase 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176933.3-920s1c1
Sequence:CCGGCGAGTACATCGACGCAGTAAACTCGAGTTTACTGCGTCGATGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176933.3-830s1c1
Sequence:CCGGCAATCACTTTGAGGGTCATTACTCGAGTAATGACCCTCAAAGTGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176933.3-543s1c1
Sequence:CCGGACGGACATCTGCCTGCTTAAACTCGAGTTTAAGCAGGCAGATGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176933.3-170s1c1
Sequence:CCGGGCTGATGAACCGGGATGAGAACTCGAGTTCTCATCCCGGTTCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176933.3-813s1c1
Sequence:CCGGGTCTCTTCAGACTGTCCCAATCTCGAGATTGGGACAGTCTGAAGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176933
VALIDATED
DUSP4 MISSION shRNA shRNA Plasmid DNA
dual specificity phosphatase 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176933.3-920s1c1
Sequence:CCGGCGAGTACATCGACGCAGTAAACTCGAGTTTACTGCGTCGATGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176933.3-830s1c1
Sequence:CCGGCAATCACTTTGAGGGTCATTACTCGAGTAATGACCCTCAAAGTGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176933.3-543s1c1
Sequence:CCGGACGGACATCTGCCTGCTTAAACTCGAGTTTAAGCAGGCAGATGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176933.3-170s1c1
Sequence:CCGGGCTGATGAACCGGGATGAGAACTCGAGTTCTCATCCCGGTTCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176933.3-813s1c1
Sequence:CCGGGTCTCTTCAGACTGTCCCAATCTCGAGATTGGGACAGTCTGAAGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176933
VALIDATED
DUSP4 MISSION shRNA Lentiviral Transduction Particles
dual specificity phosphatase 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176933.3-920s1c1
Sequence:CCGGCGAGTACATCGACGCAGTAAACTCGAGTTTACTGCGTCGATGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176933.3-830s1c1
Sequence:CCGGCAATCACTTTGAGGGTCATTACTCGAGTAATGACCCTCAAAGTGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176933.3-543s1c1
Sequence:CCGGACGGACATCTGCCTGCTTAAACTCGAGTTTAAGCAGGCAGATGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176933.3-170s1c1
Sequence:CCGGGCTGATGAACCGGGATGAGAACTCGAGTTCTCATCCCGGTTCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176933.3-813s1c1
Sequence:CCGGGTCTCTTCAGACTGTCCCAATCTCGAGATTGGGACAGTCTGAAGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)